Description :
From Genome Similarity Track
Location :
Scaffold_1699:144- 4776
Transcript NameFunction/comments
Phypl_g13988hypothetical protein

Sequence
4632 bases(100 bases per row)
gacgccgccttcgccaccTCCCATTGGGGTAGCCTCTAGACGACCGCACCAAATGCACTTCCTTCCCTCTTGGACTTCGCCGAACCATCGAAACTTAGCA
CATGCAACACTTCCCCGTCCCCAATCTGAGGGAACGGAATTACCGTGATCTTGGCCGGTCGTCTTCGTGGCGCAATGTCTTTCAACGCCGCATCTACCGA
ATCTCGTGGGGTGATACTGGCAGCAATCACCTCGAGTATctctgcttctccacgatcGGATCGCTCAATCTTGAAACTCCAAGAGGACAACCTAGCCGTC
CACTGCGATAACCGGCCTTGTAAATTCTTCGAACGGAATAGCCATGCTAACGTCGTACGACCGGATAACACAAGGATCTCTTGTCCGGCCAACATCGTGA
AGCACTCGTCTAGTACTTGAAGTAATGACAAGATCTCCTTTTCCACCGGATCGTAGTTCAACTCGTTCGGTTTCAGCGGACGGCTTACGAACTCCACTGG
CATGGATACCCCGTCATGTGCTTGGGTTAATGCGGCCGCCACGGCCCAGTCGTTAGCATACAAGATGACTACCGGTTCCCGTTCTTGGTCGTAATGCCGC
AGAATTGGAGTCATGACCACTTTGTGCTTAAGTATCTCGAACGCtgtggcggcgctggtccaCTTCTCATCCGGTCCGCTCGACGACGTTTCCAATTCGC
GATGAAGTCATCTTCCGTTAGCGCGTATAGAGATGCTGCATAGACCGCAAAATTATCCATGAACCTGTGGTAGTAGTTCAAGCTACCCAAAAAGGACTGT
AGACCCTTCAGAGTCTACGGGAAATCGAGCGCCACTAGCGTGTCCAAATTCTTGGGTTGGGCCGCCAAACCGCGTCGTGAAACCGCATGACCGAGGTAGT
CGACTTATCCATTCCCCAGTAGCTCTTCTCGACACTGATAGACAGTTTACAACTCTCATAAGCGTCCAACAGACGTTCCACCTTCTCACACAAATCCTTC
CAGGTCGTTCCTCCAATGAAAATATCATCAATGTACGACCTTCGGCTCAGAATGGAGGGTCTCCTAGCATCTTCGGCCTCGCCTTTGGTAAAAACGTCCT
GAACGGGGGCCGTCGGGATTCAACGGAAACCGTACAACGCATTATCCACCAGTCTTTGATAAATCTGCGGCGCGTCCTTGAGGCCGAACGGCATACGCAG
CCACTCAAACAGCCCGAACGGGGTGATGAACGCAGAGATTAGTCTTGCCCGGTCGGTCATCGGGACAACCCAGAACCCACTGGCCATGTCCAGCGAACAG
TACCAAAGGTAGGGGTTTAGATCTTCCAACAAGTCACTGACCAGAGGCATCGGATTCATCATGAGCTGCGTCAAACCGTTGACCAGACGGTAGTCGATGC
ATAGGCGGATGTCCACtccgttcttcttgatgatgACCACAACCGGTGACGCCCAAGGCGAAATAGACGGTCGGATCATCCCTGCACTCAGAAGTCCCTT
CAACAACTCAGACACCTTCTCGCGAAAACATGGTTGTATCTTCCGTACACGCTGGGCGATCGGCTTTGCATTTCCCACGTCGATATCACACACCACACCG
ATCGCGGCTGGCGGCAACGCGTTGCTCTTCCCGATCATCCACTTGCGACGTCTCCAAATAATCCGACGCAACCGCTCTTCCTGTTTGGCATCTTCCTTCG
GAAACTTCGACTTTGGTCTCCCAACCTTGACGTCGTCTATCGTCACGTCGGCGGTTAAAGACACATCAGGTAGGAACGCCATCTCCTGTTCCATATCTTC
CGCGAACAAATTGGACGCTTCGTGATAGAACACCTCATCGTAGCCCAAATCCGGATCGGTCATCGTCGTAGTTACAGCGACATCCGAGAtagacggcgct
ggtggagtcttctccttctcggGTGAACCGGGTGCCTTGTCCTCGTCACGATCCGGGTCGGAACGCTTCAAGGACAACGCGACTTCTGCTTGATCCACAA
TGTTTGGGCCTTAGCGTCCGGTTCGTTTGAAACCGTATCACTTAAGCCTTCCGAGAGCACGTGGATACTATCTACAGTCACCACCCCGTGTTGCACCTCA
TCATCGATCTCGGTTTCTTCCGTTCCCGTTCCCGTTCGCCTTCCGTTTCCGTTCTCAGATCGGAGTaccgccaccgccacttGAAGGGGGGTTCCTCCTC
GTCGCAGAGTTGCCTTGGGGGAGCGTATTGCCGTCGTTCCGTCATAGGtcctgcatctccagcatcgaAGAAATCTCCGTTCTCCACCGCAACACCGTAC
ATAAGGTTCTGCCACTCTTGATATCGGCGAGAGCCAATCCGCACAAAACCGTATTCACGAGGTAGCTGGTCTTTTGCAACCCACATCGCAAGTTTGGTGT
GCGTATCCAGCGTCAACTGTGAGTCGGTCAGATTCGTCCCGATCGCCCGTTCACCACTGTAGTAACCCAAGTCTTGCCTCGCGTGACCCAACAGAGTTTG
TTGATCACGGGTGTCGTTCTGGAGACGAACGTTTTGATCTTGATGTACTCCAATCTGGATCGGACTCGTCGGCGTAACGAGACGCGTTCTAGGTCCGTAC
AACGGACGTCGGCCAAGCATGTGAAGACGGAACTCGTCTGGTAAACACACCGTTCCATCGCCTGCATCGAGACCGATACCCGCCGGGACCATGAGATCCA
TTCCCAGGATCGCGTTCTGGCCCGCGAGATCACCGACCCAAGCCTAAAAAAGTAAACGAGGTTGCCGGCCAGGGTAACCTTCAGTCTTGTTCTTCCAACC
GTGTAGTACGTCTCGTCTCTAATCCCCACACATTCTTGCGTTCTGTCTGTGTCAATGGGGCAGCCTACCTCACGAGCAAAGTCGGTGTCCACAATAGACA
CCTCGGCACCACTGTCGAGCAACAGAATAGCCGGATGATTATCCAACTTCCCTTTGACCTTGGCCTGGCGAAACCACTTCTCAGGAGCGTGGTACTTCCA
ATATCCACGTTTCCCTCCGGGAAGTAGTTCCATGACCGCGATTGGAAACGCGCGTGCAAATTCATCGTGATCTCGACGTAGACTTAACACCTTGGAGGCT
AGTAGTCGGCTGAAATCACATGTATTATCGAGAGATGTAgactcctcttcctcttgcacCGAACGCTTGTCAACAAATGCATAGACTAAACAGACCGTTC
GGCTCGTACTGGTTTCCACACCATCGAGCGATCTAGTTTAACATCTGCTCCGCCGTCGGTGGTAGCATCCCTGTGTGCTTGGACGGGTTATATCACTGAC
GTAAGAGGTTGAAGAACTCTTCCATCGGGcattctccagcagcatggacGTCACCACGCGCCTTGCAGACGCGAAGGCAGCGATCGGACGGATGACGACC
GCCACATTTGGCACacgtcagcagcgtccagcagTCCGACTCAGGATGGCGTGTCGAGTTGCAGTGAGAACACGGAGGGTGCATTGTGCGGTCCATTCTC
CGTTGGATCGTCACGGCGAGACACAGCTTCGGGGCTCCGCTGGGCGGTGACACAAAGTCTAACCCGTTCCGCATCTTCGAAGTCCTGTCCGTAGTCCCAC
TCGTTTTCCGGTTTGGCACTGTCACGCTGGCTGGTCCCATCTGAGACTCCGGTCTGGACCGCATGGACGGCCCGTGGAGGCGCGGCTGGGGTCGGAGCCT
TCTGGCGAAACTTGGTCGATCCGAACAGTGATTTCTTCTAGTTATCCAGATCTCGTTGCCTCTTGCGGAGCACGGTTTCTGTAATGGGCCTTCCAACAGT
TATATAAGTAGTTAGATATTACATAAGTGGTCATAGGTACACCCGGATAGCGGGTGCAGAGNCCCCAGTCTACAGACTTGGTCTCAGTTCCCTGAGTCCT
GTTgcaagcttcctcatcgctacgTGTAAGCTAGTGACGTTAACCACCTAGCCCGTTACAGTTTCAAGGGTCAGCACATCAGGTACCATAAGCATGGTTA
ACTGCATGGTAAGTTCGGGCTCCTGATGGTTCAGGGTTCGCACATAGTGTTCTACGTGTTCGCGTTTCTGCTCCGCCGATCCTTCTATGAAGTGGAGTCC
GGCGCGAAGGCCAGCCACATTCAAACGGTACAGATATTCCAACGGGGTCTCGTCCGACCGCTTGGTCGCATGGTAATAGCGGCTTGCTATCGATACTCCT
TTTCCGCAGTATTGGATCAGGAACTGGGCGGTCAGCTTCTCCCAAGACGTTCGCGTCTCCCGGCCGAGTTGGAGGTACCATTGTCGGGCCAGACCGGTCA
TCAAATCACCGAAAAGACTACACACTTCACTGGGGCCCATGTCATCACGGCGGGCGGCCGAATGGAGTCTGTTAAACCAAGAACGCGACTTCTCCTCACT
GGCATCTCGGCCGCTGAACTCCTTCAGTTCCGAAAACGCCGACATCCGTACACGGGCAAGGGAGGGTTGGCTTAttccagccgccgccgctgccgctacA
GTAGGACGCCCGGCCAGTGTTCCGCCCAGATCAAAGAAATCTTCTGGATCGTCGGACATACCGTTCCGCTCCCGATCGGAGCTGACCATCGAACTGACGG
ACTCCATCGGTTCATCTTGGTCTTCACGCGGT