Description :
From Genome Similarity Track
Location :
Scaffold_1323:144- 2967
Sequence
2823 bases(100 bases per row)
GGAAAGACCCTTCTGTGCTTGGCTGGATCAAAATTATTGGCGGATTCTGGTTGGTAGAAATTCTTCCATCGGGACACTTGCCGCACGTTCGTGAATCTTC
GGCACACCCATGACACACGTAGAAGCCAATGATCCCCCGGGATGACCTTTCTTGCCACACTTCTCACAAATCAGATTTTTCCAGCATCCAGAATTCAGTG
TGCTTTCCGGGAATCCGGCAATGTGAACCACCTTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGGATTCGGTACTTCCCCACGGTCCCCGGGTACGGT
ATCCCCCCGGTCGAGAGTTGTCTCGGGTCTTCGCCGCTAGATCATTTGGACGGCAGTGAGACAGCCTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCG
TCGGATCCTGACTCAATTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATC
CGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCAAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTC
GGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACATGTTCGCGTAGTACCTTGGATCCCCCATCCTTGATCTTTAAGGGTGGCCCGTAGACC
GGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGGCGTGCCACCGACACTCCCAATCCACAGTAC
TGGGTCTAGAAGCTGCGCAGTAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGTCCCGCTAGCAGATCCGCAA
AGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTGGATCCTTGCC
CGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAA
GTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTCCCTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGCGGAGCA
CTTGCACTTGTGGCACGGGCGCTTTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGA
AGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTG
GCTCGATCCTGGATGGATGGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGACTTCCTGTCCTCGGCTCCTCGCCCGCG
CTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGC
AGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATGCT
ATGAGATCCAGATCTAGCTCGAAGATATCCTCTGCGTCGAACGCACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCA
GCTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATCACAGGATCTTGATGCAGGAAGTC
GCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGATCTTCTTCCGACTCTGGAGCTTGCATCTTC
TTCCGCGTAGTCTTACTCGTTCTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGTGTTGGCTTAGCTGGTGAATCTGCAAATG
CATACAGGTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACGCAAGTCAAGATCCGTAGGGGTCCCCGAAGGAACCTGGGGAGGATAGAGAGA
TTTTTCTTCTAGATCCGGATCCACCTCTCTTCCGTAGACAAAGTTCCTCCCAGGACCCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTC
GATCCGACTTCCGACGACGCCTCCTTCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCA
CGCGCACCTTTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCC
GATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGC
TTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAAGCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGC
TTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTTGCCTTTGCGTTCCTTTGCGTCGTACTTGCCGCCTCCTG
TGACGGGAACTTGAGAGTTGAGA