Description :
From Genome Similarity Track
Location :
Scaffold_2813:144- 1979
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_2813-abinit-gene-0.6Phospholipase D; Pi-TM-PLD

Sequence
1835 bases(100 bases per row)
AAGCGAGAAGCTGTGACGAGGGAGAGACGTCGTTTCGTCACGTACTATATGACGGCCCATCTGACCAAATCTCGTTGTCACCGTGTTCGATATGGACCTG
ATTTGTGGACCGTTTGAGGCGGATTGGTGGATATGAGCCTCAATGTCCACAACCTTGATCAGCTTTTTGACCAATCACAGACATGTACTACTACCCCGTA
ACAGTGACACTGACATCTGCGACCTTTCATGATGGATGGGAAAGTGCAACCACCATGATTGAAGTGCAGTGAGTGAAGGCGTCGGACGGGACAGGGCGGC
GCGCGCACGTCTCTTATATTCTAACGGCACGATAGAAGTGGCTTTGTGGTTGCTGCTTGAGTCCGCCATTATAGACGTACAACAGGAGTTGAGGATGCTG
GACCAGCAAACGAGTGGCGAGACGAGCGAGGCGAGTCGCCCATCGCGTCGTGGAGAATCCGCTGCCACCGAACGAGTTACAACTCGTGACGTGGGTTGCC
ACGATCTCGAAGAAGAAACGGAACAGATCCCGCGGCAGCTCGAGGCCAAGTTCAAGAAGCTCCACGCGGACGCCACACGGGTGCGGGACTGTCTATCATC
CACAAAAGCCCGATATGCTGATGGTCTAATGTTCTTTCGCGTGGCAGTGGGCGCTAGTGCCCAAGCCGTTTCTCTTGCTCATTGTGTTCTGCGTGGGATT
TGCACTGCTTTCCCTCATTGGGCTGCTTGTCATGGCGACATCATCGTCAGACACAGACGCAAGTGACGAGACGGCATCGTCTGGGTTCCTGTTGGCCGTC
GGCGTGTTCAGCTCCATTGTCGGCAGTCTCCAGACGGCTGCGGGGTACTGTGCTCAGCGACTCAGCCACCAAATCACTGCGCTGCTGCGTCGCCGTCAAC
GACCCCAGCGGTCCGAGTCTGCTCGCAAGCACCTGCTGTTTTACGTTGGTTTGCTGCTGCTCGTCTGCGGCACGATCGCGGCGGTCGTGAATCTGGGCAT
CCTGGGGCAGAGTGTCACGGCGCCGTTTGCTGCCATGACGCTTGTGTTCAATGGTTGCCTCGCGTTCTTGGTACTTCACGAAGCAGTGACCAAGATTGAC
GTGATTGCGACTGTGCTCGTGCTGTTGGGTGTTGGGGTCGCTATGCTGGGTGTGGGCATGGCACAGCTCAACGCGCAAGCGTTCACGCTCGAAGACATTG
AATCCACTTTCATGCGGTCGCCGTTCCCGGCCGTGTACTCGGTGACGGTACTCGGCTCACTCATCGCATCGTTTGCAGTCGTCCAGAAGCGACGCCTTGA
GAAGAAACCGGCGGGGCTGTGCTGCTTTTCCATTGGTGCTGGTGTGCTCAGTGGGTTCTCAAGTTTGTGCGTCAAGTGCACGGTCGAAGTCGTGAAGGGC
GTTTCGCAACAGCACTCGAGCGACTTGACTAACCCGGTCTTGTACGTGTTCGTCGCGGGCATTCCAATCTGCGTGCTGTCTCAACTCAAGCTCATGACGC
TTGGCCTCCAGCACTTTGGCACGCTCAAGTTTGTCCCGCCGTACCACGCGTTTATCATCCTGTCGAACTTGGTCAACGGGATGGTCTACTTCGACGAAAC
GAGGGGCTACGATGCGCTCTCTGCCTCTGTTTTCATCGCGGGGTGTGTTGTGACAGTCTGCGGGATCTTCGCGCTGCTGGCGAAAGCACCGCGAGTGGTT
GATGTGGAAGCCCATGTGAAGGCATCTTTCCAGTCGCCGACTTGTGTGAAGATTGGCGAATCAGCACGAGGCGACAAGATCTCAACGGCCAGCACAAGCT
CCAGTGGGAGCGATTTCGAAATGACGCCGGCGTTG