Description :
From Genome Similarity Track
Location :
contig_38:143931- 147647
Transcript NameFunction/comments
g8709.t1hypothetical protein

Sequence
3716 bases(100 bases per row)
CAAATTTGTACGTTGAAGTTGGTCCCAGTCTTGGCCCTTGTAGGGAAAGCAGCAAATTTCCAGTACAAGTAGCATATCGTGCACAGCAACCTGAACGGTA
GACGACGACGATTTCATTTCACTGGGCGCATTATCCACTCCGCTTTCAATAAGCTGCTGGACTTGGCGCAGATGTTCTGTGGATGCCTTGAGAAGGAATG
TCTGTAGTTCGAAAAATTCTTGCCCTATGTCCTCGGATAGCTGAGGTCCAGCAAACTCAAGGTCAACAAGGTAATGCACTTTGACGGTTGAGTTTTGAGG
TGCCGATAGGTTCCCCGAGTTTTGGCCACTGTTAACACGAACCCGCTTAAATGCTGAAGACAGCATCGGAATAACGTGGAAACGCGAGGTCGGTATAGTT
TCCGTGCACTGGAGTAGTCGAACGAACGTCTTCAGGCCTTGCAGGCGCTTTTTAGCGCGATTTTGATGTGCCAGCAAGATGTCTCGCATTTGGTCTTCTG
GGTACCGTGATGACGTCTCGTTCTCTTTACTGGAAGTAATCAGGCAGCTGCTTGACTGCTGAATGAACGCAAAAATGTCCGCATGGACCTGCTCGTCTTC
CTCTTCCATTACTTCCATCGACTTTGTTTCCATCAGTCTGTTCAGCTGACGGGTAAAGCGTTTTTGCTCAGGCTCTTCCGGGTTAGCCTCGATCGGCTCT
GTTTGGTCCACTTTCGCGAAATCTGCAATTGTAAAGTTCGTAAATAACACCAAGTGAAAATGACTAATATAAAAGTATAGTCCTTACCATAGGTCGTTGC
GATCGAGATTCCGGGGAGGAGCTTCATTGGAGATGATGCTGATGGAGCGCATTGGATTGGGGCAGGTGCTAACTGAAGAAGCAGCTGTGCTCGACGAATC
ACAGGCTCGCAAACAGCATTGTATAGTGCTTGCTGTCTTTCCTTCGCCTCCATATCTGGAGAAAACCCGTTTGGTGCACCCGTCTCACTGCAATACAAGC
AACAATTCTTAGAATCAACATTTCTGGCACGGAGTACGCAAATCAGCTACCTGAAAGCAGCAGCCAATTTCTGTTGCTCTCGTACGATCCTGATCACAAC
GCACAATCACTGATGTTAGTCTTCAAAGGAGAGCGAGAACAATTAAATATTCAAACCTTACCAGCGGCGAAGCTGAAGCGCAGCCTTCCAGGCATCGACT
ACCGCATCTGCCAGTGCGCCATCGTTTGAAATAGGTTCCGTTGTGTAGGAGATATTGGTGTGTTTCAAAAGAGCCGCGAACGTAGCACGCACTGCCGGTC
CACTGCCTCGATTCCACCACTCTTTTCCAGTGTCGCTTCAACGCTATCTTGCCTTTTCAGCCTTGCAATTCGTAGCTGTGGATGTGTGCCACCTGGAGCC
GAACCGGGATCTAGAGCATTTCGAACTTTATCCAAAAGCTTTTTACCACTACCAACGTTCTCCATCACTTGCTGAAGAAGCGTTTCATTTCGAGCCACAC
CACTATCAAAGTTTGCATCGAGATTAACTTCTTCCAATCCACCACGAAACAGGGGAGAGTACAACCACCGTTCACTAACAGCTACACCGTCATCTAATTC
ACCACCGACAATCAACGTTGCAGCGTAATGACTTCCAACCCAAATTAGTACTTGTTGAAGGTCCTCTAGCCACTCGTGGCTTTCGTCAATGGTTTTACCG
GAGCACTGCGCCATCGATGGAACGGGCTTTGAGAGTGAGTATGGTGCTGGGGGTGGTCCCACGTTGTCCTCAGTTTTTTCTGGGGTAGGTACAAATCGCC
CACTCATAGGGTATATGTGTTGCGAGAGAATTGTCCGACTGGGAACAAACGAAACTTTCTGTGGATCATATTCAAAAATTCCTGCCTCGACCCTGGTCTT
TTGAATTTTAACCAACAGTGCGTCTGTCCCAAAAAGCTTTGAAAGCTCCGAAGGAATAGTCAGCCTGCGAATCTCGGCGTCGTGGGGCAAATCTTTAACT
TTCCAGTATGTGAAACCCTTAGAGTGAATGATCTTCTCCCACAAGCTCTTAAAAATTCGCCCATACGTGACTGATGAGCCACTACTCTGGTGAAGTAGGT
ATGATGAGAGCTCTTTCGAGACGGTTGCAAGCGCATTATCCTCGGAATCAACTTCTACTTCATTTTTTTTCAAGGCAGCTGGTGATTCAACACCAACAAT
TGGTGGACGCAAAATACCTCGTTTGCTTAGCAGTACAAGTGCGATATGAGTTTTGCTCGATAAAACTTCCAAGTGAGACCAAAATGGGCTTAGTATATCA
GGAAGTGCATCGCGAACGGATGGTAACGAAAGCACGCTCAGCAACATAAACGGCAGTAATTTACCAGCAAAACTATGCTGAATGAAGATGGGGAGAAACC
GGCTCTGCTCTAGGCGCATTGTTTCACAACGATCCAGATACTCCGAGATAAATGACACCAACTTCGTGCAGACAGATTCAATTATAACCCAGGTTTGCTT
GGTAGAGCATGAACACCAAAATATAGTTGCGCGAACCATAATGTTCAGACACTTGAATTCGTGGCTAGTTTCAAGAGCGTCTAGCTGATTGATGAGAGCA
GTTGCATCTTCTGGTGAGCACTCCACCACTTCCTTCGTTTGCTCCCATAGAGCATCCAATAGTGTGCCCATGAATGTGATTACAGTGTTTGAAACTACAG
CTTCCTCAGAACTGTCCACCTTCAACACCTCCTCAGGGTCACTCATCAATTCAAATAACATTTTCCCTGACGTGAAGCAGGGTACAAGCATCGGAATCAA
TAATTTCTGTGCTGGGGTTGGTTCTGCGTCCGAGTTGTGCTTATTTACCATCAAGCGGTTCATCACATTAACCTGTCCAAAAGGGACGGAAACAGCGTTG
GGAATCCGTAGTGATTGTCGATGCTGTTTCTTGCTTCACCGCATGGTAAAACCACAGTACTTCTCCTGACATCGATACTTTTGGTACGTGATCTGCAATC
GAAAAAAGTAACTCACGAATTGAGTAAAGAATCCCTCCAGGTTGAGATGCTGCAGCTGGCAATCCAACCTCTGACCCGTCCAAGCAGCTTCGCGAAAACT
ACCAATTAGAAGGGTTTTGACAAGGTGAGTAAACAAGACGCCCAATAATAAACAAAGGCGAAGCAGGAGACCACGTACCTCAAAGAAATTCAGCTTGAGA
AGCCTTATTGTTACAAGTAGCGGGTACAGAACATGGATAACCTGCGAAGTGGGGTTTGGCGTCTCATCAAGGATATCCATTTCAAAGTATTGCGACGTGG
TGCGTTTCAGCACTGCGTATAAGGCGGACAAGGTCGACTCTTTTGGATCAATGCATAGTGATCGATACAAACATCGTGAGAGCTGGATAGAGTCCGTGTC
ATCTCCTGGAATGTCATTCCCAGCTAAACGATCCAAATGGGATAGCAAGCAAACGCCAGAGTCTAAGGCCTCCAGCGCACAATGCTGGTTCAACCTGTTC
GTAGAGTCACATCTAGCCCGAAGGACACCAAGTACGTGGCCAGCTTTTCCTGTCGTCGAGATGTTTTGTGTCATATCAAGACTGTACGATCCTGACGCGT
TCACTGAGCAAATCTTTCTAATGCAGCTGGTACTCGTAGCCTTCCCTTGTCTTCTAATGCGACCCCCAACTAGAAATAAGTCACCATCTGGAGAGGAAGA
GGAGTCGACATCAGAG