Description :
From Genome Similarity Track
Location :
Scaffold_19:14390- 18992
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_19-snap-gene-0.18Protein PNS1
Pytiw_DAOMBR242034maker-piw_contig_19-snap-gene-0.19Ancient conserved domain protein 2 (Cyclin m2)

Sequence
4602 bases(100 bases per row)
TCAGCGACAAGGACGACAAATCAACGTCGACGAACGCGCTCTCTGCGGACGACACGAAGAAAGTGATCGCGATCGCGGTCGGCATGGCGGTCGTGGCCGT
CGTTCTCGCGCTGCTGCTCGTGAAGCTCATCACTGCGGCGGCGCGCTTCATGATCAACTTTGTGCTCTGGTTTAACGTCGCGCTCTCGGTGGCGGTGGCA
GCGTACGGCTTTGTCATTGGCAACCTGTTCCTCGGCATCATCGGCGCGATCATCGCGCTGCTCAACTTGTGCTATGCCCGTGCGGTTCAGCACCGCATCC
CATTCGCGGTGGCCAACCTGAAGGTCGCGGAGAAGGCGATCTCGAAGCACAAGACCACGTACCTCGTTGCAATCATCTGCACGATTGTGCAGATCGTGTG
GGTGGCTGTGTGGGCGCTTGCGCTCCTTGGTGTCGCGAACAACATGAGCACGGACTCGAACGCGAGCTCGACGGGTTACCTAGAGGATGGTGCGACCTGC
TCGATCAGCTCGCAGTGTCTCTCGGACTCGTGCAAGCTCTACAGCAACGGCCGCAAGTGTGCGAGCACGACGTCGCAGTTCTTCAAGGCGTCGGGGACCA
CCTACGTCGCGTACTTCTTCATGCTCATCTCGTTCTACTGGGGACTGCAGGTGTTCAAGAACATTGGCCACGTTACTGTCTCGGGCACGGTCGCCACTTT
CTGGTACAACTCGGAGTCAGCTGGCGCGACGGGCTCGTCGTTCAAGCGCGCGACCACGACTTCGTTCGGCTCGATCTGCTTTGGCTCGCTCCTGGTCGCG
ATCCTCCAGGCTCTGCGCGCGCTCGCGGAAAGCCAGCGTGAGGAAGGCAGCTTCATCGGCTGCATCTGCGAGTGCATCTTGGGCTGCCTGCAGTCGCTCA
TGGAATACTTCAACCGCTGGGCGTTCGTCTACGTTGGCATCTACGGGTACGTGTTGTATTATGTTTTTGTTGTTGTAATGTTAGCGATACTAACTGTGTG
GAATATAAATTCGTGGTATTGTGCAGCTACAAGTTCACACAGGCCGGCAAGGCGGTGATTGATCTCTTCCACCAGCGTGGCTTCGATGCGATCATCAACG
ACGACCTCATCGGCAACGTGCTCAGCTTTGCGGCTCTCGGCGTTGGTACGTGTAGCGCACTGAAATTTTTGTGGCAAAGATGGTCGAGATGGCTTACATG
GTATTCAATTTTCTTGGTACTGAACAGGTTTGATCTGCGCTGGCATTGGCGGTGTCATCGGTGAAGCGACGGACATTGTTTCGTTTGACAACAGCACGAG
TAAGTTCACTGTGAAGGTGCTGGATTCCGGATGAGATGCGCTGAAAGTGATACTAACAATCTATCTGTGCTGCATCTGCAATGTTTTCAGTTGTCTTGGC
GGTGTTGGGATTCCTCGTCGGACTCGGCGTGTCGATCACCCCACTCGCTGTGATTGACAGCTCTGTGGCGACCATTTTCGTTTGCTTTGCTGAGGTATGT
GGCTGTATTCCTATCTTCGAAGTTGATAGAGATGGCTCAGAAATTGTGTCCTTATGTTCGCAGGACCCTGCTGCCTTCATGCAATCGCACCCTGAGCTCT
ACAACCCGCTCATCGCCGAGTGGCACAACCTCTACCCTGAGATTCTGGTTCAGGCGGGTTACTGGCACGCTTAGTCGAGTGGAGCTGTGTGGTAAACCCC
AGGATCAACGACTGCAGTTGATCCTCTCTACATATTCTTTCTACGCGAGAAAAAAACCCAAGGACCTCGTTTCCAGCGCACGCGAGTGAGTGAGGCAGCA
CTAATGGATGGATTTAATGGCGAGGTTGTGAGTTCTTTTGATGCAAATTCTTGTCGCAATCACAGATTCGCTGAGCTGTTGCTGAGCTGTTGTGTTTCTC
ACGAGCTGGCAGCTCTATTTCAAATTTGTCGAAGACTTTTCCAGCTGAAACGACGCGAGATTGCAAATGCGACCTTTGTTATGAGTCGCAGAATCTTTCC
TGACTGCTGATCAACTCACGCGCTGCAGTATCTCTTCGTGTGTGTCTCCCATGCCGACATGGCGACTGAAGCTGCGGGTCGTCATCACCCACGCAACAGC
ACTCGCCACGTTCTTCACACTACCACCAGCAGCAGCAATGACAACCATCGATGACAAGACAGGTGACGACGGTATCAGCGCGTCAACCGTCATGCTCGAG
ATCTGCCGATATACACTCATCCTGGTGCTCGTGACGCTCTCCGCAATCTTCTCCGGTCTCACGCTGGGACTCATGTCGCTCGACCGACTCGGGCTCGAAG
TGATCATTGGCGCTGGCGAGCGGGACGGAGCGAGCGACGACGAGTGCGCCAAGGCCGACGCTGCCCGACGAATTTTACCCGTGCGCGAAAATGGCAACAC
GCTTCTCTCGACGCTCGTGCTGGGCAACGTGTCGGTCAACTGCCTGCTATCAATCCTCATGGCGGACCTGACCAGCGGCTTCGTGGGCTTTCTCGTCTCG
ACGGTCATCATCGTGATCTTTGGCGAGATCATCCCGCAGGCGCTCTGCTCGCGCCATGCGCTCCTGATCGGCTCCAAGCTCGTGCCGCTCGTGAAGATCC
TGCTCTTCGTCTTCTACCCAGCGGCCAAGCCTGTTGGCGCAACGCTCGACTACGCTCTGGGAGTGGACCTGGGCACAGTTTTCTCGAAACGGGAGCTCAC
AAAGCTCCTGGAAATCCACGTGCAGCAGCAGACGCTGCATCCAGATGAAGGCCATATCGTGCGAGGCGCCATGGGCTACAAGCAAAAGCTTGTGAGTCGG
ATCATGGTGCCTGCCGACCGAATCTACTCGCTTTGCGCCAGCACGAAGCTGAGCATGGACACGATCAAGCAGATCTACGCGAGCGGCTTCTCGCGCATCC
CCGTGTACGGCAAGGACTCGAACGACGTGCTGGGCATCGTGTTCGTCAAGGACCTCGTGTTCATCGACCCCAAGGAGAGCGTGCCCCTGCTCGAGTTCGT
CCACGTCTTCGCGCGTGCGGCTCACCGAGTCTGGGCCGACTCGACGCTCGGCGAGATCCTGAGCGTGTTCAAGAAAGGAGGCATCCACATGGCGCTCGTC
TACGACGTCAACAACACTGGACCTGTACGTTTTGATTGCAATGTTATTCTAACACTGATGTAAGCTAAATAATGACTGGTTGCGGTTGATTGGAGACAGG
GCGACCCGTTCTACGAGCTCAAGGGCATGGTGACGCTCGAGGACGTGGTGGAGGAGATCCTGCAGGACAAGATCGGCACGGACTCGGTGGAGGATCGCCA
CGAGCGCAAGAGCTGTGCTGATCGGATCACCCTCGACTATGGTACGAGAACGAGCACATGACTACACATGGATGGCTACAGTGCCATCGATGCTCCATGT
CCTAACGCTGTGCTTTGCTGCTCTCTGTTGCACAGTTTGAAGAGAAGTATTGAGTGGCTCAGTGACCATTAACTATCTTATAGCAAAGCCAATCGCCAGC
TCTCCGTGTCCCAAGCCAACCAATTTCCAAGGCATCTGCTCCTTTCTGGGTAGCCCTCCCCTATTGCTGCTTCTTACAGACGACGCACCGCTCAGCGCTC
TCTTCCTGGAGTCGCAGAGCGTACGTGGCGCACTTCCAGCGCAGGAACGAGCGCAACACGGCAAACTGGACGCTCTTCACCTCCAGCTGCTGCTGCTTTC
TCTCGAGAAGTTTCGTCTTGTCCGCCAGCGCACTTTCGAGTATCACGCGGATCTCGTTCGCGCTCTTGAGCGACCCGACCGCGTGTTCGAGGATCGCAAT
GTTCGAGTCGTTCACTTTGCGGCAGCGTTGGTCAGTCCCTTGCCCGTTCGACTCGGTTGTCGTGTGCTCTCGTGGTGCAGTACCCTTGGGCTCGGCAACA
GCCATGTCAGCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGCTGCCACGGACGCTGACGCAGCGAACGCAGCGATGGCAGCTCGGCTTGACGAGAACTCGGACCTCTCGTCTATAGCCGAGCGCCGAGTTCCCTG
CCTGGGTCTGACTTGGGTCCTAGTTGAAATAGTGGAACTTTGAGCTCCTGGTGATGCTGAGGCTGAAGATACTGTATTGCTGGTTGGCAAAACACTCGAT
CGTACGGACTGCAGGCTCGAGGCTGCGTGCACGACCTCGACGACCCGCTTACACGCAGCGTAAAACTCGTTGGTCGTGAACGTCTGCGACGAGACCGACG
ACCGAAGCGTCTTGTAGGCGCGCGTGAAGCCGCAGGCCGCGTCGACGATCGCCTGGTGGCTTGCGGCCTTGCGCTCCAGCTCGTCAACCAGTCGCTGGTG
AAGAGCGACGAGTTCTTTCATATCGCTGCAGCGGTCCTGAAGACGCGTGAGCTGCTCTTCGCGGTCGCTGAACTCCTCGATCTTGCGGTCGATCGTCCGT
CG