Description :
From Genome Similarity Track
Location :
Scaffold_142:14390- 15482
Sequence
1092 bases(100 bases per row)
TGCATCTTTGCGGGGGTTTTCATGCCGCTAGAAAATGGGGGTTTTCATGCCGCTAGAAAATCATATACCCCCCCCTGATCCGATTATATTAAAAATTTCG
TAGACCACAGCCACAGGAAGATCAGTGGGGATTTGCGATGCGAGGGCAGGAAGGACCAACCCTGGGAGCTACCACAGCCTCACTTGCTACCGACGATCTT
GCGTGCGTGTCCCCGTGTAGCGCAACCAGCAGCAAATCGGCAGACAGCTGGGCAACGAGTGAGCATCTCGTGCAGCGTGATGACGATACGGGCAGCAGCG
GAGAGGGAGAATTGAACGAAGAGGGGGTCCTCCATGAAAGGGTCTCGTATAGCCAAGATGATGATACTACAAAGACGTAGGCAAGCACCAAATGTCTTGC
CTGCAAACAAAGCATTTGATGCGCGGAGCACATCGACTCCGCAGACGTTCCGTAAGCGGTTCGTGCCAGATGAGGACTATATCTTAGCCGTTCAAGTGAA
CAAGGATACGCCTTTTATGGCAGAGCACGGGTCCATTTAGAAAGGTCTCAGATGCTTGCAGATAATCTTAATGCCTGTCCTTACTTCTACATGAAGCACA
TCACGGGTCAGACAACCCAGGCAAGATGTCATAAAATTGTTAGCAAGTTTCGTGCGTGGGAGAAGCAGTCGGCCGGTTTTGTAGGCTGTGCTGAGCAAGC
AACACCTTGCATTCGTGTGATGACTGGATTAGTATCGATGCTGGCTGATCGGGCGCGAACGTTAGCCGAGAACGCTTCCGTAAATGCGGACATCGTGTGT
TCTAGAGCCCGGGCAAGCGAAGTTGTTCGGGTGGCTGTAGTATCGGATTAAACTTGGTAAACGGCGAGTGAGTGATAACGCTATCCAAAACAAAGAAGAC
AGACCAAAGACATTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN