Description :
From Genome Similarity Track
Location :
Scaffold_1897:1439- 3036
Sequence
1597 bases(100 bases per row)
GTTGACACGTCTCACACGTGCGTACATAGGTACCGACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACC
TAAGTGCCCACCCACGGGCGTATCATGAACCTCGTAGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTTG
GTGCTGTAGTACAGCAGGCCACCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAAGCGCGCAGACAATTTCTTGTCAGAGTCTTTTAACTCTTCGCTCC
CAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCCTGTGCATACGCTCTGCGTATCAAGTCAGGCATTGACGACGTCACTGTCGTGACATGAGCTAATTC
GTAGTCCGGCCTGCGTGAGAGCGCATCGGGCCACTACATTAAGCCGCCCCGGCTTATACTTCACCTCGAAGTTATACTTGGCAAAGAAGGAAAGCCATCT
TGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAGCGACGCATGATCAATAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTG
AATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTAACGGGGTTACATGGTGTGGAACACACAGGGGTACGAAGTACCCGGAGAGTTAACAAACT
CTCTCAGTACGTTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAATTATGCTAGATAGTTAAAGAGATACATTTACCCCTAGGCGGCTTGACGG
CAATAATCTTAAACATCTACTGCAGCAACCTGTCTGTCCGTCACACTAAATTGTCGTGCCTGTCACGCTTTTCCGGACAAATCATTGGATAAAATGATTT
AAGTATTTCTACTGGTTGCCGAGCGCAGCGAAGGTGGCTTTAATTGGTTAAAACTAGATTGTGTTGTTGCATCAATAAATTCATGTGTTTCCCAGTTTAC
ATATGGGGATTTGCACAAGGCTGTACATTATCCAAAGGCATCGTTTAAATATTATATACCTTTTTTTATAATGCATGTTGCTATTGATATTTGAGTACTA
AACGGAGGGCAGGGTGCCTATCGTACACGTTAGCATGCGTGTTTCCGAGGACATGGTTTAAGTATACTAAATTCTCTGTACTCAGTAGGATCTGCGTGTT
ACACTGACTAAAATGATAATTTCAATTTTTTTACTGTAAAAATATTAGCATTAATAAGTTATCTGAGTGGGTTTCTGGTATTGCTAAATCGTATATGTTA
CATGTACAGCAGTAGCCGGTCGTGTGGACTGGTCGTAAGAGCAAAGCTGTGCTTATAAACGTTGTCACTTGATTCACAAAGATAGAAAGTTTTAGATTGA
CGTGTGAACAAAAGAAGTTATATGTGATGATGACAATTACTACTGTGAGCGAATTGAACTTGACCATTGTTTTCTAAGCGGGTTTTTAGACAACAACATT
CTGATACTTATTAATAGGTTGACGCGTTGCCGACAAGGGCGTAGAATAAGGTTTTGCATGCAGCGGTAAGATAACAACACAACATGAGAGGTGTAAA