Description :
From Genome Similarity Track
Location :
Scaffold_16:143857- 146528
Transcript NameFunction/comments
Sapdi_VS20SDRG_05901hypothetical protein
Sapdi_VS20SDRG_05902hypothetical protein

Sequence
2671 bases(100 bases per row)
GGCATGGGCATGCGCGGCGCGTCGCCCGTGGCGCGTGCGGCCGTCTACTTTTTCCTCGTTGTCGCGCTCTCGACGGCCTACCTCGTGGTGGCGACGACCG
TCCTCTTTGCCAAGGACAAGGACGGCAACGCGGACCCAGAGGCGTGGGAGAAGAGTCTAAGCATTTTCTTTGGCTACATTGCGGGCTTGTACGGCATCAA
CGAGATGTTCCGCGTCTTCAACTTCCAGGCCGGTGGCGTCGCGGGCATTGTCGTTTTCCAGCAGCTCGCGTTCCTCTTCGACTTTGTCTTTGGCGCGTGC
CTCCTCATCCCGCTCATGATTTTGAGCTGCATCCCGTTCATGAATGCGATCCAGACGCGCATGATGTACAACGAAGGCTTCTCCAAGGTGCTCTCGGCGT
CGTCGCAGCACGCGTTCTCGCTCGCAGCGGCCATTGGTGGTGCGACGGGCTTTTCGTCGGGCTGGCTTTTGTACCTCCTCACGACGCTCGACATGTCGCC
GGGCTACATCAGCTACCTCTCGACGTACAAGATTGCAATCTCGACGGGCTCGGGCTCGACGACCTACATGGTGATTGCCGCGATGGTCGGTGGCTCGGTG
CTCGCGGGTGCGTTTGGCTTCTTCCTCGGTCGCCGCATGACGCTTGTGATTGCCGGTCTCCTCTCGGGCTGCGGCTGCTTGGCGCTGAGCATCATTCCGT
CGGTCTCGTCGGGCTCGGCCAAGCTCATGCTCATGCTCGGTGTCGTGCTCATGGGCGTCGCGCTCGGCATCCTCCTCCCGACGGTCACGTGCTACATTTA
CGAGATCTCGACGGCCGACATGCGCGGCAAGACGATGCTGCCGCTTGCGTTTACGTTTGTCGTCGGCACGGCGTTTGCGTCGTGGTACTCTGCGGGCGAG
ATTGGCTGGGTCTGGCAAGCGTTTTGGTGCGCCGTCATCCTTGCGATCATGACGCCGATGATGAACATGTTTCCCGAGTCGCCGCAGTGGGTCCTCGAGC
GCAAGGGCGTCGAAGAGTGCGAAGCGGCGCTTGGCATTTTGCGTCAGAAGCCCGACAACGCCGACGAACTCCGCGAGATGCGCGAAGAGAAGAAGGAAGC
GTCGGAAGCGGCGGCCGGCGGTGGCATGTACAAGTTTGTTGTCGCGTTGTTGCTCACGATCATTCTCTCGCTCTCGACCAACTCGCTCAACATTTTCGTC
GGCAAGACGTTCAACGGCTTTGCGGACAACAACCATATGTTCACCAACTGCGTCGTCATTGAGGCGTTTGGCGTGCTCATCAGCTTCTTCCTCATTGAGA
AGACGCCGCACAAGAACCTGCTGTCGTTTACGCTCCTCGCGGTCGCGCTCTTTGCTGGCTTTCTCGGTGCCGACGACAAGTTTGTCATCATCAAGCTCGA
CAATGGCAACCGCAAGCTCATTCTGAGCCTCGTCATGTCGTTCCTCTACTTTTTCAAGGGTCTCGGCCTCACGTCGGTGCTCTGGGTCAACATTGCGGGT
CTCTTCCACACGAGCACGCGCTTCCTCGCTGTGCCGTTTCTGTACATTGTGTTCTTCGGCCTCAACGCGGCGTCGCTCCAGCTGCGCCTCAACAAGCAGA
CCGAGACGGCGTACCTCTGGCTCTTTGCGCTCGCTGGCTGCTGCCTCCTCGCCGTCTTCTTTGTCATTGTCGCGGGCTCGCGCGCGTCGAGCGGCCTCAT
GTGCACCCGCGACGAGATGCGCAAGGACAAGAAGCGCACCGAGCGCCGCCGCAGCTCGCGCCACTCGCGCACGCCCGGCAGCTTTGGCCGCGGCCGCCAC
TCGCGGTCACGCTCCAAGTCGAACGCCAACAGCTACCACCTCGTGCACTCGCCCGCCAACGGCGGCCAACACGTCTAAGCCAGTGCGTTTTTTGATATAA
CTCTTTTATACACCTGCACATTTGCCTCAACGTCAATGTCTCTCCACCAGAGCTAGTCAACACTGTTCCTAGCCCGTATCGCACATGGTACCGGTGGTCG
CACTGGACACGAAGCGGTCACGGGACTTGGGAGTCGTCGAGCGTTGACGCCCGAGGCAACCCACTCGAATCCATGCCGGTCAACGCTACAAATAATGGCG
GTGGACTAGTTTACACAGTAGTATCATCTTTGGGTTATATAAAACTAGAGACTATTCTGTACATGAGATTATGCGCAGTGAATGCGGTCGGTGCGATCGG
TCGCTTCGAGAAACTCTCTCCAAACGACGGGGAACAGGTCGGTGACGTCGTGCTGGACCGTCTTTTGCGCGCTGGCGTTGCCGGCGCAGCTCGCAAGGCG
CACGGATGCCACGTAGCTCACAAACGCCTTGCCGAGGTCGCAGTAGGCGTGCGCGTCGGTCGGTGCGAGCTGGAGCCAGTTCGTGATCGCGACGAACCGC
TTCTCGAGCTGCTTGTGCGTCAGCGAGAGCGCGTCGTCCGGCGCCATCTTCTTCTTCTTTCCCAGCACCGCGACCAGGAACGCCTTGGCCTTCTCGCGGA
TCGCACGGAGACTCACGTACCACGCGGTCTTGTACTTTTGGAGGCCAATGACGGCGCCGGTGCCATCCACATACAAATTGACCTTGCCCTCGGTCTGGTA
GCCGGTCTTGATGGCGCTCAGCACGGCCTTGAACTCGGCGCCCGTGTACGGCACGACGTCGTACTGGACGG