Description :
From Genome Similarity Track
Location :
contig_5:143836- 149957
Transcript NameFunction/comments
g1315.t1hypothetical protein

Sequence
6121 bases(100 bases per row)
TGCGAAGTCTTCCGTTCCGACTGCTAGCCGTGAATGATGTGGATGTGCGAGATGCCGGTCGACACAACTGGCACCAGCCCGGTGTCGTCGAGGACTCGGA
GCACGAGCCGCTGTGGAGATCTCCGCCGTAAGCACTGCGAAGCCCCGCCCGCTCGTCATAAGGTCTCTCTCCTAACCTCGTATTCCATGTGCAGCAACAG
CTCGTACCCGCAGGAGCTAGGGCTGATTCTACTGTCAGTGGAGCCTGTGACGATCAAGAGTGTGCGGGTGAAAGTGGAGCTTACGCGAACGCCAGCTAGA
CGTGAGTGTTATTCGGACTCAAGCGAAACAACCTTTCTCGAGTAATAATTGCTGCTTGTTTGGCCAGTTGAAATTTCGGTTGGACGACAGAAAGATGTGG
TTGCTTCTGGCCATCTCGATGCAGTGTCTCGCTATTTCAGTGCGGACTGGACACCAAGCTGGTAGGAACATTTTACTGTGTCGGTGCGGCTCACGAATAC
TGATGGTCTGAAAATTGTCCTATAGCGAGGTCCTGATGTGGGAGGCGCGGATGGACATACCACAAGCAATAAATCCCAAGGCTGTTCGTCTTGATGTGTC
AGACTGTTCGTTCATTAGACTCGTTGTGCACGCGCCACACGAAAGCGCTTGTAATCGATCTCACGAGGTGCTGCTGCATTTTTGAACTGCTGTTGGCATT
TAGTTTTCTATACGTGGCTGACTTTTCTGCCTTCATGCAGGTCGTACTGGAAGATATAGAGCTGTTAGGGCTAACTGGAGGTACATCTTGTCGGGCTCGA
AAGCTGGACCCAAATTTGAGGATAGTCGACAGGCAGGATGGTCCGTTCGACCACTGTTTTGGTCGCATTCGCCGCCCCTTATTACTTTCTCCGGACAACG
ATAGTGACGAGTTGCAAGCTGTTTTTTGGATGCCGGCGTACCGATGAGTATCGTAGCCCAGGTTGCCACGATCCCAATCGTTGAAGCTGTAGTATCGGCT
TCAGCGCATAAAGGCATCAAGCCACTTGCTGGAGCTAGTGAAGTCGTTCCTAAATCAATCCCTCAAGATAACGAACTCACCGGCGTCCCAAAGAGTGACA
GTGGCACCATTGCGCCGCTAATAGGTCGCGATAGCAGCGACCAAGACAGGGGCCAACGTCACCTTTCGACCGAGCGCTCCGACAATATATCGAGCAAACA
GCTCGTGAGAAAGCTATACTCGAGAAAATCCTTGCCACTGAAATCTGCGTGACCACAGACGACGTTGCGAGTTGGCAATCTCCCACGATATCACCCACTG
ACCCCACTAACAGCAACGAGATCACGCTATACACGTTTGGAGAATTTTTTACACAATGTCTGCTCTGTGGTGGATCCGATATCCAAGTAATGTGTGTACA
GATGGCTGAGCGCTTTGCTCGACTTCTCAAAGACGTCGTTGGTGCAACATCTGCGCTCGAGGGTATCGTTGCACTTATCATTATAGGTGTTCGGGGGGCA
AAGTCTTCTCGTGTGTTCCGCGCAACGATTCATCTAGCACACACTGTGTTTCTGACTAAAATGGCAAATACGAAGAAGACAACATCACAATATCAACCTG
GGGGTGGCAATACCCAGAATACAAATGACCCTGCAGCATCTGTCAGTACGTCGTCGCTAGGGCTAATAGAGGAAGTTGGTATCACCAACGTGAGCTATGG
GTTGCGAATCATTCTCGAGTCAACACTTGCGAGCCAACTTTGTTGGTCCTCCATTAACCACGCTAGCAAGCCAACATTTCGTTCGAGTACCAACCCACAC
AGCCGGAAAGTTTCGGATGGGCTTCCTAAATTGCCTCCGTCAATCGACAGGGAGTTTCTGTATTTTATCCGGTCGCTGATCGAGCAAGATCTAACACGTG
CAAGCTTTTTCGAAGAGCTTCTTGGTCTTACTCCTACCGACAGTGCTGCCGGGGTCATTTTCACGACAAGCCGATTGCGATTGCTTCGGTTGATCTTGCG
GGATGACATGATTCACTGTCGAATTTCAACCAACGTGAAGGCCAGTATACACTCGCTTTGCTCCAACTGGTTGATGCCGAAAAGGTCTTCATCCCGTGCT
CTGGAAAATGCAAACCTTGATGACAAAGATGCAGTAGTAATACGACTTGCTTCGGAATGCTTAAATGAAATAGACCGATCGTCTTCAATTTCTCAACAAG
CCAAGGATAACGCCAACCTTGTCAAGGGTCTATTGGTCGCTGTGCCCACACCTGCAAGTCGCAAGTATTCTAAACAGACATCGCTCCAACTGCCACTATC
ACACTCTGACTTTGTTCAAGACCCGCTTACGGAATTGGAGATTGCTGAGTTTGCCAAACAAATGCAGCGATACTTTTCATCCCAGCCTCGTCCGAGCGCC
CTGTATCGGCACGTATTTGTACGTGCACCTCAAATTATTATAGAGAAGGATGAAATGGAGCAATGCGAACTGTTTCAAAAAGGCAACATCACTTTCCAAG
GGCAAGTTGTTGCCCGAACACCACCGAAAGAAACTTTTCACGAGGAGATTCAACGAAATGCAGCTTCATTTGTGTTCGACGTTGGTACTCCAAGCAGCAC
GAAGGTGGCTGGTACAGCACCGCCACACCACCAAGAAGTGGTCTCGAGTTTTGCAGCTTTTCGAGGAACAATCGAACAGCGTAGCGATCCCCCCAAACGG
ACGCGCAAAGTTTCCCCCGAAGATCACTTACAACCTCCCAAGACCACCAAAACTCTAGCGGTGACAAGTAATCAACCTGGCAAGAATGCTGTCAGTAGAG
CAACCATGATTGTGTCAAGTGATGCAACTTCTGCTGCTGCTGCTAAAAGCTCAGTTCAGGTCGTAGAAGACTCAACCAATATTGCAGATAACACACTTTT
ACAGGAAGTACCTGCTGTAGCTCCAACCACAAGCACCGATTCAGTTTTGCTACCTGTCGCTGTTACACAAGACCCCACCAAGCAAAAAGCAAATCCCTAT
CAGCCTGAACGGGCCAAAGTCAAAGGCAAGGAGAAACGCAAAGGCAAAAGCGGTGCTAAAGATCAAGACAACTGCGTACTTCAGTAACAGGCTATCAGCA
GCAAGCTAATAACCAGTGCTCTTTCGTGATCGATAGCTTTGTACGCTCTGATTCAAGGAAAGTTCATATCGCTCCTGGAGCTCCGTTGATAGCTTCTTGA
CGTAATGTTTCATTATGAATTCTTCGTCAACGTCACAGCAGAGGGCAAGTACTACCTGCTTAGCAGCTTCGCGGATAAGGGAGATTTCGTGTTGAGCAGC
GCCGCTAAGCAGCAAAAAGCGAAGGATACGTCGGGGCGCGATATCAAAACTTGCACAACAGTGAAACGACAATAGTAGCGCTGCTAAAAGCTTCAAGATC
GCTAGAAGCTGCTGGTCTGAGTGTTGGAAGTTTCTCCTCTCGGCATCTTTTAGAGTGAGGTGCGTCACGAATGTCCCTCTTGTTCGTGTTGTCCCAGCGA
CCTATACACGTGTTTCCAAACTAGCGTAAATTCACTGCGTGGAGGCGTAAAGATTTTATGGCGTACCTACCTTCAAAATAGTGAACGCAGCAACATTGCG
AATTGGCGCCTCGCGTGCGCCAAGCCTGTCTGTAAGTCGGGCAACAATTTCGGTAACCTATATCACATATCGAGCATTTCATGAGTTGTTGTTAGCTCCA
GATACTGTAGTCCGAAACTAAAGTACTACTGACTTACATCCAATTTTGAAGCGGCTGCATCTTGGAAGTATGGTAAACAAGTTAATAGTGCCCGTAAAAA
CCCGCAGCCGGCGGCAAATACTTCGGCGTTTGTGTCATCCAGAACTACAGCCAATATCTCTAACGCTTCTGCACCCGTTATCGCAATTTGGCAACTTTGA
TCTGTTACCTGCGAGCACTCTGCAAGCTGCCATAGTAATGCTTCTCTCTCTTGCCACTGACTTATCTTGAGCCTCTTCAGTATGTCATGTGCTTTAAGCC
CCTGAAGTGCTGTCAGCGCATGTTCATCTTTATCGCGCGGTCTCGGCGAAGAGGACATTTTCTGGGATAGCATCTTCTCTAGGTGATATCTGCGTTGCTC
AAACTCAGCAAACATATCGAGATCATTTACATGTTTGGTATCTTCGAGCTCTTTTCTTTGCCCAAGTAGATTGATCAAGTGGCTAGCTTCCTGCTCCAAG
GAAATCCACGGCTGTATTTGCTTCTCATTGCCAGCATATTGAACGAGTTGCTTGCCGATCTGAATGTCTGCGAAAATTTGCTCTGGTGTCTTCATTTTCT
GGGTGTCTTGAATCCAGATATCTGCTGCCCGAGGGGATCTCATTTCCCGTTCTTGCGCTGGGCTGGGGGTGGTCGTGTCGTAAAGACTATGGACACGACG
ACGAGGTGACTTTTTTGATGCACTCTTGAGAGGAGGTGGTATCAGTGGCAGCGCCACCTTCGCAATTTTCTGCGGTTCGAAAGCTGCTACTGATGCCAAT
CCAACTTGGCTAAAGAGATTGGTTCTTGTCTGATGGCACGGATGCAAAACCAGACGCAACAGTGTAATCTTCGAAGGTTGGGGAAGCTGCACCTCCTGAA
GTTCGCAAGCAGCACGCTGCGCCTTTTCATTGCTGCGAAAGCACACAAACCCAAGCCTCTCGAATCTGACACCGGTCCTACCGTCGTGAATTCCATTGCT
TGTGGCTGCGGACGTGAAAATCTCAACTCGGGTCGCCACTTTGAACGGGTGCGATAGCAGATTCACCTGCTCAATGCATGTCGGTAAGCCTCGATTGACG
CGAAATACCAACTCTTGCGGGAACTCGCAGAATTTCTCCGATTCCCACACCGCCAACTGGGACGACGGCAAGGTCGATGCGCATTGGGAGCGTGCAGGTT
GGCTGCGGGAAAGCGCACATCCTCGCTGGAGCAGTACAGGAGTTCCAGCAGAGAAGAAGCCCGCTCGCCGTCACTCATTACTTCAATCAACCAAATGCCA
ACATGAACTCGGCACAAATGACTGTATTTTGGCACGTATAAATAACTTCAACGGCAACAAAAGGACGCTCACTCGTTTTCCAGAATGATGGTTTTTATGT
GTACATACACCAGTCTTTTTTGTTCCAGAAGGACCAAATCGGCACAATTGAAAGCGTCCGCGAATCTCAAGATTTAACCTCAAGTAGTGGAGAGTGATGC
CGACGTTGAGCGACGAGGAGCAGGAGCTGATCCAGAAGGACCGCGAGGCCAACCCTGGCTGCTTCTACTCGACGGCTCTGTCGCAAAGCTGTAGGTCCAT
CAACGGCGACAGCAAGTGCGAGATCATCAAGAAAATCTTCCGCCAATGCCCCAACTCGCGCAAAGAGCTCATCTCGAACCGCAAGGAGATCACCGAGGAC
GAGCACAGCGGAGAAGCGTCCACCGGCGACTTTTTCAATCGGGAGAGGATGGATCCACGTAAAGGGTACGCGCCGATTGGGACGGAGCTTTTAGAAACTG
AGTGCTGACCGTGGGTTTGATGTATTGTGTTAAGCAGAGGGGACAAGGACTTCTTTTTCCAGCAACGGTATGTTCATTTGGTCTTTTGGAAGGGGTTTTG
GTGTCTGAATCTTTGTTGCTATTTGCTATCAGAGGTGATGACTTTGAGGCCCAAATGAGTCCATTTGACTTCCTTCGACAAGAAATGCTTCGTCCATTTG
AAGGTACGAGCTGTCTGCTGTTAAGTGAGGAGTTTAGTGGTGGTCTAATGATTTGCTGTGCTATTCGTGCTCCTGCTGCAGATTTCTTCGGTGGTGGCAT
GATGGGCCGTGGTGATTTCAATCCTTTTGAAGGTCTAGAGGGAGAGTTTGAGCGGATGCCGGTGCGTCCACCGTCGCCCACACCCAATCGCCCTTCACGA
CGACAGGCTCCTTCCAACCCTCCACACTACTCCTTCCAGCCCTCACAGGGAAAAGGCCCTCATGGTACGCTATTACATGTAGCTGTTTTAACATTTGTAG
TGGGTTACTGTCTCTAATGCTAATTTTGCGATCTTCCTGCAGAGGCCGGCGCAAAAGCGCGCGCACAAGGCAAGAGCGATATGTTCGCTGACTACTCGGG
TCGTGTGGATGAAATTTAATG