Description :
From Genome Similarity Track
Location :
Scaffold_146:14383- 20514
Transcript NameFunction/comments
Phyag_g2715hypothetical protein PITG_06931
Phyag_g2716myotubularin-like protein

Sequence
6131 bases(100 bases per row)
ATCAGCTGGGCTGCAGGATCTCGTTGTCGCGTTTTTAAAGCGGCTCGATGCGCTGCAGGTGGGGTTGTGAATTACAGCACATAATTTGCTAAGTATTTAC
ACTAGCTGAATGTGCATTTCACAGGAGCGTGCGCATACTCATAATCGAGTTCAAGACAAGCGATCACGGCGTTTCGTGCTGGGGATGCATGAAGTGCGGC
GAGGTCTCCTCTGCAACAAAATAGTTttgctggtcgtggcggcGGATCTGGATGGATGTGAAGCTGTAGAAGAAAAGCATTCCGAGTTAAAGGCCCTCGC
AATGGAGCAGGATGTACCTATACTTGCTCCAATGAATAGGTTCGATGACTTGTGCCTGCACGTACCAAATTCTGTTTGCTCGGCTAACTGTGTGATCTTG
ATTCGATACACTACGCAGAAGAAAGTTGGGGAGAGTTTTGCGAAAGAACGTGCGCGTGAGTTGTATGGGAGTATATTCTGTCGAAGGCGCCAACGATCTC
TTCAAACAGATATTGCAAAGTATGAAGGCTACACTTTCACGATGACGTTTTCATTGCTTTACTCAGCGCCGCTGAGTCAGCGGTGACTTTTTCCCAGTTT
CCAGTACTCGTAATACTGTCTTGGGTCAATGACAGTATCGGCTTCACGGGTTTTCCTACAACAAATTTCCATGAGATCACCATAAGCTGCAAGCCCAACA
CCTGACCGACGTACCTCTTCTTTTGGTTGGCAGCAAACTCGTTGATGCGTCTGCATGCTTGGACTTGACTCCTGGCAATGGCCTCGTTAACCAATGCAAT
GTACTGGAGGAAAGCTTCATCTTTGAGCATGGGCATGCTATTCGCCAAGATATTACCCTGGAAGCCACCATCcgagttgatgctgttgtttTGAGCTAGG
CAGTCTTCCAGAGTCGCAACAAGTTTCGACGTGGGATGCCCAGCACGTAGGCCTCGCGCGACAATGTATCGCTCGGAGCTCGCAGGGCGACTGGTCTGCA
ATCATATCATTAACATGTTAGCTGTGTACAACAACACCTTCACACGGTGGAATAAAACAATCGACGGGACGTACAATAGGTTTCACGATTGCAAAGCGGT
CGAAGCAACGATGCAGAAGCCAGCAAAGCTGAATCATGGCAGGTGTCGCCAATTCGAACGTCTTGCACACAAAGTCTCCTCCAACACACAACACGTTAAA
CATGGCGAGCACCTCAGCCAAGACCAACTTGGTCATCATCGATTCCTGTCGGTAACATCTCAAGCTTAGCTTCACTCTTCACAAGGCAGAAAAAATCGGA
GCTTCTGACCTGGTTTGATTGTGAGCGAGCATCCAAAAAGCCTCCGTCAGCTACAGCCAAGTTCACACCAGTCGGATGACTTCGTCGTACAACGTCACGA
AAGTTGTGGATGTTCGCAACCGAGTAAAGGTTCCCCGTTCCGTCCTCACCGTAGCAGATCTCAAAGAAATCGCGAAATTTTGACGGTAGTCGCCAGTCGC
AATTGTCCGAAGCATCTTTCAGCGTGATACCGTAGCCACAAACACGTTGaacactttcttcttcgccgtcaGTAGCTTGTGCTGTTCTCCACAGCAGATA
CTCTGAGAACCCTCCTGGCCCTCCACAAATGTCAGCAAAGGTGAACACTTCTTCGCGTTGCTCTACATCCTGTGTCCACTGAAAGATATGGTCCAACGTC
ACCAACTTCATCGCTGAGCGATTCAAAAAGCGATGTTTACCTAGCGATTCAAACGAGTTCgtagcagctcgagcactcAAAAACTGTGACTTCTCCAGTG
TGTCAAACTTGCATTTCTCTCTctcgagttcttccagtAGCGAAGCGCATGGCACTAAActtgcatcttctccatcgttttTCTTGACGCCCTCGTCCGG
CAAAACATCATCAATGTTCTTCTCTTTGCACAAAAGATACACCACTCCTTGGGGACCATGCTCCATGCTGCCGCGCGAAAATCCCGCAAGCTTCCCCGCT
ATCTCCGTTCCAGGCATCAACTGTGGCAGAGCATCAGTAGTTTTGTTTGCGACCTGCTTCACGTTGTGGCGTTCACGAGGCCGTCCAAACGCTGAAAAGC
CCATGGCTGCCATCACATCCTCGTCGCCACTCATTTTGTCGGTAACGTTAGCAGATACCGTCAAAAGATGGAGTGAAGCACAAACACGAACGCCCTGGAT
GAAATGGAGTGCCATCGACTATATTATACTGACTACGAATCTATTGCTGTGGCGTGTCCTGCATGCCTTCCTCCACGGCTCCAGCCACGTCTACTAAACG
CTCCGAACACGCAAACTCACAAAGCAGAAGCAACATCCAAGCTTGCCACTAGCCGTGCCACGCGACGAACAGAGGAGCGCAGAAGATCAGCTTCGATACA
TCTCCGctctcgccttcttctgcttgcgctcACCTGCCTAAGAATGAGTAGACCCATTCTCACTGCCTACCACGTTTGAGGCGGTGCCATTGTTAATGCC
ATTGGAAGCGACGCTGGGGactcgaacagcacgatgCAGAACCGAGTCCAGCTCtgcctcaagctgcagctcgcgcgcgACGCTCTCGCTCAGCAACTGC
TCCAAGTACTTGATGCGGCTCTGGTCAGgtgccaacagcaacgcctCGCGTATGTTGCGCCCTTGCGCACGTTGGCGAGTACGCTCTTCGACTCCGCGGT
GATACCGGTTCAACACACCATCGTCCACCGGAATGCGAGTCTCGGCGGAACTCTCCGAGTCTGCTTCGCTAGTTGCCGGCGTCGTCATATTCAGCTCGTC
TGATGTCAATGTCGACGAGCCGTCGTACCGCGCCGTCACACTCGAGGAAATCTCAaagtcgtcatcgtcgctcaTGTCAGAGCAATCCGAGAGCGTTTTT
GCCCggaactcgtcgaagtcgtgaATCACGTCGATATCTAGTTCAACCTTGTCTTCGTCAAGATCGCCGCCTATAGGCATTACGGATGGCGAGTCGAGTA
CGCTGGCACCACGAGGActgtcatcttcgtcgaagTCGTTTGTCGAGGCGTCGTCGGTCTCGCCGGAATCCATATACTCCATGTAGTCCGGGTGGCTTTC
AGGATCCCACCGGAAGAACATGCCATCCCACAGCACAACGCGCTTCAGGTTCGCTCTCGGGTACAACACGCGGTTCGTCGGTCGGTACAAGGGGTTCTTG
TACGGCCCTGGGTTCTCGAGCACAGGCGTCCAGACGGACTCGGTGCGCTCCCACACCTTatccagcacacgctcgCGTTCCGAGTTGTACAAGAACGTAC
CGTACAGGCCCGAAATCAGCGAGTCAGCAATATGAATCAGGAATTTCTCGTTGAACTCGAAGCACGTGGGGAACTGTCGGGTCATCTGCCACACGCAGTC
CAAAAACTGCAGCATAACTGGTGATCGCTCGTTCGGCTGGTCGGTGATGTCCTTACCCACGCCAATTCTGTCAGCGAACTTGTGTCCGAAAGAACACCAT
TCCTTTTCGACGAGACTGGCGAACCCGCGGATGGAGCGGTAGAACGGGTCGAGGATAAGCTGCGCCAGGGCTACAAGCTGCGGGGTGCGATCCCAGCCGT
CACTGCagtgcaccagcaccgaaGCGCCGTCCTCGTGAAGAACCTCTGCTACTCTCCGTGCACCGGACAGCACACGCATGACGTGCTTCAGCCACCGAGT
GTCTGTAAACATAAACGAGAACAAGATAATATGAGTTTTTGAAGACAAGCAACAACTGGAATATAGAGCTTGCGTACTCTCGAGGCGGTTGTGATAATGc
ttgtcgccatcttcaaCACTGCTAGGACTGACGAGGGCTGCATCAAGAGGAACAGGAGTAATTGGGTATcagtcaccaccaccaaactTTTCTACAATAC
TACCATAACGAGTGACAAACCTTTCAAAGCATCCAAAGACTCGCGCATCTTGTGGATATTGGCGATGCCCATAAATTCGATGGTCGCATTGTCGTAATGC
TGTGAGTTCTCCACACCTGCGAAAACAATAAAAAAGCGTCAGAAATCGAATTCACAATAACACCGATGCAGTCTGGAGCGTCAGCATCTTACCTTTGCCC
TTTAACCGGTTACCCTTGGTGGCGATGGGCTTGCGCGCGTCGATAATGTGAAGAGGTGGCGACATGTTCGAGCTGTTCTTGTTCGCTGAGTCGCGGTACG
CGCGCAGAAGTATCCGGTCAGGCTCGGATCGGTTGCCCGCCATTCCATAGTTAGGTTGGCTTGAACGAGACAACACGCTTTTGTTCACAGGGTGGCGCCA
CACGACAACAGGCAGACGAGCGCGTGATCGGAAGCGTGCCGACTGTACTAGCTGCTCCTCCGACATGAGGGACGGCACCACCATAAGCTGTGGGTACGTA
GGACTGAAGCGAAACTTGGAGTTCTTGAGAAGTCGCCACGTGATCACTCCCTCCTCTTCTGCTTGCTTCTTAGCCGAGAGAAAGCCGAGACGTTGGTACT
CAGCGAAGGGTGAGTACACAAACCAACCGTTGTGCTTTTCAGGAAGTGGCgcactgcgctgcttcaccttctccgtgTGGTAGTCGAAAGCAAAAAGCGC
TCCGATCATGTTAGGCGGCTTCATGCGCAGCGTAAGCAGATTCAGCCACCGGAAGTCTGGCGTTGAAGGGAGCTGGTCGTATCCTTTTTTCCGCGAGTAC
GCATCGTGCATAGCGAGCCGCAACGTTCGCAAGTCCTTGCATGTGATGAGAAGCATGAGACCATCTCGTGTGATGAGATCGATCGCTGCAAGTGGCAGCT
CAAACGATCCGAACTTCCACGACGCATCGTACGGCACGAACGTGATGCGATACGACGTGATCTTGAGCACGCCCTGCACCGCGCGGTCGCTCTGCGTCAT
CACCACTAGATTGGTCACACGCTGCACGTGTTCCAACACCGACTCGcccggcagcagctgaaaGTGATCGCTCACCATAGAGTCTCGGAGCTTAGAGCGC
TCAAAAGTGCTGGACGCTGTGGACGCCGTTTCGTCAATAACCTCCGTCGGTACTCGCGACGGCGTCGCCGCACTCGCAGCTTTCTTGTTGTACATCACCT
TgccctgctccagcgcctgaACGAAGTTGGCACGATCTTCTGTACTGTAAAacgtgatcttcttgttcacgcTAGCATTGCCCGTCTggatcttgagctg
catGCCAAGTCTTGATTGCGGCTTGGCCGTCACTGCAGCGCAGCTGTACTCTTCTCTTTGGTCATGAGCCGACAGAAAGTAAAGCATCCgttcctccacg
tccacctgCAGTTGGATGCTGGCTCGCTTACTTCCTAGTTTCTCCAGCACACTGTcactcttcttcaccgtAAACGTGAACAGCGTCACCTCTGACAAGG
GCACCGCATTGCGGTTAAACCCAAACACATTGCTACTGTGCgtcgatctgctgcgtccgttctcgaccaagaagttggACGACGAGTCGCTCAAAGTATC
CACATTTCTCGAGCTCCCTCCGGTTGCTGTAAAGTGGGCGGGGCGATCATAGAAACTGTTGCTCTGCGCTGTAGTGGCATAACTACCCAAGGAGCTTCTC
CCCACCACGTCAGGGCGAGGGATCTCCATATTGTACCTGGGACTGGCTCTTGTTTCCATATTCACCGTATCGTTCGTGTCGACGACCAAGTCCCTGGAGC
CTAACGGAGCTGTAGCTACCCATTTGCTGGCATTCGGAGGACTATGGCCCCCTCCGGAAGGCAGCAATCTGACCGTCGCAATATCATCCGCCGCTTGCGT
CGAGATTTTCCTCCTTGTCGAGGGGGTTCTGGTGGTGCGTCGAGGACTGGCGTTGATGCCCTGAGAGGccgagaagttggtgctgttggccgCTGGAGAT
CTGCTGGAATTCTGGCGCACCGGCATCGACACACTGGCCGAGAGTCCTGTGGCCTGGACTGGGGGCGGAGGGGACTCGCTCTCCTCGCTCGGGAGTTTGC
CGATGAGCTTCCAGACGTTCGTGGTGGCCTGGCCAGCCTGCGCCaggttcttctcggccatgagcaacttgtccagcgtggcCGAGTCCATCGTGGACTG
ACGCTGAGCCAAGTACGCCTCCTCCTGGTCG