Description :
From Genome Similarity Track
Location :
Scaffold_173:14381- 17083
Transcript NameFunction/comments
Phyke_g5947hypothetical protein PHYSODRAFT_347295

Sequence
2702 bases(100 bases per row)
CCCTCTTCAGGCAGCGCGTGCTTATTTTTTGCTTAGCTTGATCGGCTTGTGGCCGCAGTCATGGGCGCGTGCACCGAAATTCCGTGCCAGGAACAACGTG
CTACCAAATAGTGAGCCTGCAGTGATCGAGCAGTCAGCGATGGGGCCCGTGACCACCACAGGGTGCAGTGAATGCCGCATCGTGTAGAACGCGAAGCCAC
CCTGACGGCCCTTGAGCGATGCAAAGCAGTGCGTAAGCGGCAGAGCCTCTACCCGAACAGAAATCTTGCCCGTAGCAGCGTCAATGTAGGTCATCTGGCG
CAGGTGCAGTTCCTGAGCAGGATCTGCCACTGCCTTGACGATCTGCTGCTTTAGCGGCTCGCTCGCCTTCACTAGATGCTCTATCAGGTATTCGTAGCTC
CACGCACCCACTGCATCCTCGCTACCCGACACGGTAGCGCTCTCTTCCCACGGGCTCTGGATGTCAACGTCCTTGATCTCCGTGTCGAAGCCCATCTCAC
GTGCGATCATgatggccttcttggcgctACGTACGCCCATAACGTCGTCCACGATGTCGCGTACCGTGAACTCATTCTTGTACTCGGTTATGAGGTCCTT
CATCATGGCCGACAGATCGGCCTGGGCCGGATCTGGTAGTGCAAATACGGCGTCGAACAAGGCGTGCAGGAAGCGACTGCCCGAGTATTCCACGCGTTGA
ATGTCGTCGCCCGTCTGAATGAAGTTCTGGATCGTGTTGAAAATGGGCACACCAATGGCCAGCGTCGCCTCCGGATCGAATGTAAGCTCGTTCTCGATTG
ACATCTCCTGCAAGGCGTGGTGCTGCGCCGTCGAGGCAGACGCAACGTTGATATTGGACGTCATGACGTGCACCTTGCGGGCTAACCATTGCGGGTATAG
GTCCTTGACGTGGTGTGAACTGTTCGAAACGTCGATGATAAGCCAGTGCGGCAAGTGGTCGGCGCACACATGATCTAGGAACTTATTCTTCTCAAACGAC
ACGAATTCGTCCTTGCGGGACGCAAGTGCCTCCTCAGTAATGTCGCCATCGGAGTCCAGTAGCATCTTCGATGTAATGTGTGTGCCAATTGCACGAACGC
GGATATCCACATTGAAGCGCTGCTTCAAGAActcacgctgctggtggtatTGCTTTAATAGAGCAACGCCAATGCTGTTGGTCTCGTTCTCCTCGAACTC
GAGGCCTATCAGACCGATGGAGATGGTCTGGTCCGACAGAAAAAAGGACGAATGCACGGCACGCAGCGCCGCTGCCGAGTCCTTGTAGtgcacaacagca
gaaatGTTGCGCTCTGATGATCCCTGCGAGATAGCAAGCACGTTGATTTTCGCACGACCCAGGGCGCCGAAGAAACGGGCGCACACACCAGGGGTTTGAT
TCATCTGGTCACCCACCGCGGCAATGATGCTGACCGGTGCAATGTACTCAGCCTTATCAATGTGCCCCACGTGGATCTCCTTGAAAAAAGTCTCGTTGAT
CACGTCCTTGGCCACCTCGGCGCAGTCCATGGGCACAGCAAAACAGATCGAGTGCTCCGAACTGGCCTGGGCAATAAGCACCACGTTCACCTTGACACGA
TCCAGGGCGCTGAATAGCCGCGACGATGTACCGTGCACACCGACCATGCCGCTGCCTTCGATGTTGAACAGCGCCAGGTCGTCCACCGTGGAAAAACCAC
TGACAATGTTGCGTGCAGTGGGGGCACCATTGGACATGGTGCGCTGAAGCTTTACGCGCTTGCGGTCGAAAATTTTCGTACCTGGATGTTCCGGCTCGAA
CGTATTCCGGATGTAGATAGGAATATCCTCAACAATGGCAGGTGCCATGGTCTTCGGATGGATTACCTTGGCACCGAAGTACGCAAGCTCCATCGCCTCC
TGGTACGAAACCTCTGGCAGGATCTGTGACTCGGGCACACGTCGCGGGTCCGCACTCAGCACACCGCTCACATCCGTCCAGATCGTCACACTGCTGGCAT
GTAGCACACGGCCACAGATAGAGGCCGTGAAGTCACTTCCGTCGCGCTTCAGCGTAGTCATCACACCCTCCACTGTGCTGCAAATGAAACCCGTAATGAC
CAGGTGTGTTAACTCCTCCTCTCCACTCTTCAGAATGTCCTGCATCTTTTGTGTGGACAGATCGTATTGCACCACCGGTCCGTGCTCATTGTCAGCTTCG
ACAGTCAAGAAATCTCTGGCGTCGACAAACTTGAATTGATGTTTCTTGCCATCCTGCAGCGCCCTTTGAGACAGTACAGCTGTAAGGACTTTAGCCGACC
AGATCTCGCCGTGACCGGAGATAAACTCCACCACGTTCTCGTTGTACGCCTGCATGATAGAGATGgagcgcagcagctccgagaCCGACACGAGGTCCCG
TTCAATGGCCTTCTCAATAGGCTCGCCCACCTCTGCAGGCAGCAAACTGCTCACCACATCGTGGTGTTTCTTACGGATTGTGGCCAGGATCTCATCGCAC
TCTGCAGTGCGTCGCTGCTTGGccagttccagcaacgagatgAGCAGATCGGTGACCTTGGGCTTGCCGCCGATAGCAGAgaccaccacagccacacGAG
GAGCGTTCACTGCCGACACAATGTTCGCCACCTTGGCGAAGCAATCGGCGCTGCCCACCGAAGTGCCGCCGAACTTATGAACCACGAACTTGTCTGCCAT
TG