Description :
From Genome Similarity Track
Location :
Scaffold_673:14381- 15508
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_673-fgenesh-gene-0.2Endomembrane protein 70

Sequence
1127 bases(100 bases per row)
ACATGTAGCCGAAGTAGAAGCACGTTTGCAGGAAGCCCGAcATATTGGTCTTGAAAAAGTAAAAGTAGATCGCGTAGAGGAACACGTAGACGGcAGTGCT
GCCGGCCGCGGCGAAGgACGTCCAGTGCCACCGGTAATTTTCCGAGTTGAGAAGAAAATACGTGCAAACGAtcGTCACACACAGCGTtACGACGCACAAG
ATGAGGAAGACGAGGAGCATGAAACCGTACACGTAGTAGAACTTGTAGTTCCAGAACGACGCGAAGATGAAGTACATCTCAATGAAGATCGAGCCAAACG
GAAGAATGCCCGTGAGAGCGATCATCACAGGTGGACGCAAGTACCAACGCGCCTcAGGCACCTCGCGAGGGAACTTGTTGACTCGGCAAGGGAAACCACG
CTTtGCAGCACCGTGACGACCGAGAATGGTGCCCAGCACAGCTAgCGGGCACGACACGAAGAACCagACGAGGATCACTTGCACGATTGTGATGAATGGA
ATCGCGTAAGTAGTACCATACaCGACTGCAAGGGCGTTGATGAAGAAGACGGTGaTAAAAATGACGGTCGGAAGCAGAGCAGATGACATGATCATTGCAC
GCATCCAGTCCTTCGACCCACGTGGGTAGAAGAATTGATGGTAGAACGCTCCACTTGCGTAGCCGTTGGCGAGCGAaGAAAAAGCGTAGACCGTGAGTCC
GACTGAGACAACTCCGCCTGGCTGCATGTAGAGTGACGAGATGATCGCAATCAGCATCACTAGCGTCGAGAGCACGAGAAGTTGAGCACCGGTGCCGATC
AGCGCACAAAAGAGTAGCAGATATGGAGGCGCACGGAACACGTCGCCaTGCAGCAGCTTCCATCCCGAGTTGGCGTCGTCCTTGAGCAGCGAGCTCTTGC
CATCGAGCATGAGTTCTTCAGCATCATCCTCCGCGAACTTGGCGTAGTCGTTCTTGAGGGTACGTAGAAGAATCAACGCCACCAATCCAcACAGGAAGAT
CACCATCATAAaCGaGTTgAaGaTCGAGAACCAGTGGATCTGGTGTTCGAAGAACTCATCTTCGAGGTATCGATCAAAACGCTTTTCAAaCGGGATGTCG
GTCTTGGtCcACGTGACTTCGTACGTG