Description :
From Genome Similarity Track
Location :
Scaffold_675:1438- 9322
Sequence
7884 bases(100 bases per row)
CAACCTTCTTTCTTAAGCGGGCTTGAACAGTGTCCCGTACCCGGGAGCGGAGGGGTCATTCCAGGAGCTCTGCCTCCCGTCGGGATGACTCAAGGCCCTG
GAATCACTCCTCGTCCAGCCGTCCCGTCAGGGTGGTTCCCGTTGAACCCGACAACGTACGTGTCCCTGGCCGAGCCTGTGACGGGGTCACACAGCACCTT
GCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAGAGAGCGAAGTGACCTAAATAAG
GTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGGGTTTAATACAAACTATAAGTTACCTATAGAAATGCAATGTCATTTAGCCAATGGTTG
GCTTTGAACGATCTTGGTACCTTGTACCAAATATCCCGGAGTATGACGTGTCATACTCCTGAAGTGTGAAGTGTCACACTTCACGTAACCAGGGTACACT
TAGGGCTACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTTTACCGACCAATCAGAATGAAGAGGTGTTCCTCACAAACTCTCATTCTCAAAGTCG
AAAACCATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCACTTCACAGCTAGAGCCTCGAGCAGCAACCTGTGCGCTCTTCGTCTAGGTCTCCACTTCGA
CCGTTATCATGCCTCGTGGCACTGCAAAGAGCGGTGCTAAGACACACTCCAAGGCGGCTGCCGGTAAGGCGCAAGCCAAGAGCACTAAGCCTCACGGCAA
AGGCTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGATCCTCGGGTGACGCGGCTGTGGACAAGCGCGCAAGCAGGCGTCGCAGTCCG
TCGCCCTCATCTTCAGACAATCGTCCGAACCCTCGGTTCGTAGAACGTGAGTTCAACTCGGACAGTGAAGACGATGCCGAGTCCGAGAGCACTCATGATG
CTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAAGATGACAGCGTGCAGTCGCCCACTAGTGATCACGGTGATCACAGTCCCAG
GACCTCTGTGCGCACTGAGAGTCCGGCCGTTAAGGCTAAGGGCGCTCCCAAAGCCGGTGGCGATGAGGAAGACAATCCTCGCAAACGTCTCTCGCTTGCC
GAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGTCCTCAAAGAAGCGTACCGCCTCTAAGTCTCCACTCCGCGAGGAGAAGGAGACTC
GACGCTACTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGTGATATTGTTGAGCTCCGGGAGGTCTC
GAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCATGTGCGTGGGGGTTCGGTGGCGGCACCCGTCAGCCAGGGAGCTGCCATCAACTCA
AGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTGGAGGTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGCA
TCTATGAACGAGCCCTTGTTCAGAAAGAACAGATGTTCGTCGACAACTTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCAGACCGCATTCCCCTTAAGGA
CTTCACGACCTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATTCTGTTTGGGGATACCCCTGGGTTATGCCCGAGAACTGTCCCACGTGGAGTTCT
TGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAACATCATGAAGATCAGCTGCTGTCCCACATCCTGGACC
AGCGTGATCTTCGTGTGAGGTTTGCCCCCTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGG
GTACGGTATGTATTCATCGACCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAGATTGCGACAGCCTTCG
GGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTGGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTACCGCGACACCGAAG
CTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGTGCGGAGGTGCCCTCGTACAAGTACGAGTACTCGGCGCCTCCCGA
GAGCCACTCTCGTCCGAGTGCTCCGACTGCGGGTCCGACACAGGACCCTGAGGTTGACCGCCTCCGTCAACGTGTCCTCGTGCTTGAGATTGCACTTGGC
CTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGACGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCC
TGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGAATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCCGCC
TGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGGAGCCCCTCCGGCG
TACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGACCGGCTCTCGCTTCGAGGAGCTGG
GTCAAGGGGGGACTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAGGT
CGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGG
TAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAAATATACCTAAGTTTCCTCTTCCTTGTTTGTCTGAGTACTCCTTTTGTTTATCTTGGGCC
GCTGCCATGGCATCGCGGACCCTGCTGATAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCACAGCGAAACCGGTCTCACATCCGAGACCT
GGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAA
GTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCAC
ACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCGGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTA
AAGGGAACAGCGTTTTCCAAAACGCGGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTTCGGGAGACCGTGATAGCGGAGCACGCCATCGACGAA
CAACCTGGCGGTTTGTTCGCCCGTTACAGTGACGGGAACTGGAGCAAGATGTACCGTCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCG
TGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGGAGAGTGCCCTG
CGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGGGACCGACAGAAAGGT
CTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCGAGCTTCAGATCCTCGTCGTTGGGTACGACCATTCGTGGAGGA
TCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCG
TTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTG
GGCCAACTCATAGTCGGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGCATTCCGCGAAGAAGGAC
AGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGT
GAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTCCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAACGA
GATGACTCGTTCCTGTCCAGCCGTGTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACCCTAAACGGCTTCGTCTCGTCC
GGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGA
GGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGG
CGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGATCTTTGATCTCTGGTGACGCGAAA
ACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCT
CGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGC
GTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGG
TAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCG
CTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCG
CACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGCTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCG
GGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTGTTCACCACGTCCGCGTACTCCATCACCAAAGGATACA
CCGGATCCTTGGGGTTCTTGAGAATCTCAGAACTGAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTT
CAGCTCCTCCTGAGTGGTCTCACGTCTCACCATCTCAGCAATCTCTCCAGCCTTGCGGCTGGTCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTGCAGT
ATCTCTGCAACCTCTGGTAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCTGTCTCGCCATCGAAGATGTGATAACACTCTTCCACCGGCC
TTGTCGGAGGAGCCCGGCCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGACGTCTTTGCCG
ACGGCGTCTGTGACGGGGAGCTGTGCTGCCCACGTCTATGGATGTCGTCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTTTTACCCACA
CAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCTTCCTCTT
CAGTTATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTACGTT
ACCCGCCTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTCTTCTGGGCGCGGCTACCATCAAAACATCCTTGGAGTCGTCATATACGTCGACGACTCCC
AAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGACTGCG
CAGGGCGGCTGGCACCGATTGCCTTGTTTCGCCAGTCGATCCAGGGCACGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATC
GAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGC
ACGGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCTTCGGACAACTTTTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCC
AAGAGTCAATCAAGATTCTAAAGGGATGATCGTATCCCCGTACACATCCGTATACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAG
ACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTG
CGTTCCCCTGTCCCCGGGATCCTGACTTTTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGGCAGTCACGCTT
GAAGTGGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTACGTTGGGGCTTGTTCGACCGGGA
GCCGACAAGGAAGTCCCAGACCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGC
TTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGACCCACTCGAAGGCCGTCCATGAAAACAGTCATCTTGATGTGTTCGTTGAGTGGGTTTCCCACTAG
GGACGCCGTGAGCTCCCGTATCTCCTGCACATACTCGTGCAGTTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTATTCGTAGTAC
GCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTTGCTTCCCGAGTGTACACCCAACTCTTAGCAC
GACCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAG
GTTCTCGCCTTCCTTCCCTTCATACGGCTTAACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGC
ACATGCGCGATGAGGCCCTGCTCGTACGCGTCAAATGCATTAACGCGCTCGAGCTGCTCAGCCGGTGTTGACACCACCAGGCTC