Description :
From Genome Similarity Track
Location :
Scaffold_1897:1438- 3045
Sequence
1607 bases(100 bases per row)
CGTTGACACGTCTCACACGTGCGTACATAGGTACCGACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGAC
CTAAGTGCCCACCCACGGGCGTATCATGAACCTCGTAGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTT
GGTGCTGTAGTACAGCAGGCCACCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAAGCGCGCAGACAATTTCTTGTCAGAGTCTTTTAACTCTTCGCTC
CCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCCTGTGCATACGCTCTGCGTATCAAGTCAGGCATTGACGACGTCACTGTCGTGACATGAGCTAATT
CGTAGTCCGGCCTGCGTGAGAGCGCATCGGGCCACTACATTAAGCCGCCCCGGCTTATACTTCACCTCGAAGTTATACTTGGCAAAGAAGGAAAGCCATC
TTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAGCGACGCATGATCAATAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCT
GAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTAACGGGGTTACATGGTGTGGAACACACAGGGGTACGAAGTACCCGGAGAGTTAACAAAC
TCTCTCAGTACGTTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAATTATGCTAGATAGTTAAAGAGATACATTTACCCCTAGGCGGCTTGACG
GCAATAATCTTAAACATCTACTGCAGCAACCTGTCTGTCCGTCACACTAAATTGTCGTGCCTGTCACGCTTTTCCGGACAAATCATTGGATAAAATGATT
TAAGTATTTCTACTGGTTGCCGAGCGCAGCGAAGGTGGCTTTAATTGGTTAAAACTAGATTGTGTTGTTGCATCAATAAATTCATGTGTTTCCCAGTTTA
CATATGGGGATTTGCACAAGGCTGTACATTATCCAAAGGCATCGTTTAAATATTATATACCTTTTTTTATAATGCATGTTGCTATTGATATTTGAGTACT
AAACGGAGGGCAGGGTGCCTATCGTACACGTTAGCATGCGTGTTTCCGAGGACATGGTTTAAGTATACTAAATTCTCTGTACTCAGTAGGATCTGCGTGT
TACACTGACTAAAATGATAATTTCAATTTTTTTACTGTAAAAATATTAGCATTAATAAGTTATCTGAGTGGGTTTCTGGTATTGCTAAATCGTATATGTT
ACATGTACAGCAGTAGCCGGTCGTGTGGACTGGTCGTAAGAGCAAAGCTGTGCTTATAAACGTTGTCACTTGATTCACAAAGATAGAAAGTTTTAGATTG
ACGTGTGAACAAAAGAAGTTATATGTGATGATGACAATTACTACTGTGAGCGAATTGAACTTGACCATTGTTTTCTAAGCGGGTTTTTAGACAACAACAT
TCTGATACTTATTAATAGGTTGACGCGTTGCCGACAAGGGCGTAGAATAAGGTTTTGCATGCAGCGGTAAGATAACAACACAACATGAGAGGTGTAAATT
ATGGTTA