Description :
From Genome Similarity Track
Location :
scaffold_897:1438- 2854
Transcript NameFunction/comments
Pl_101941hypothetical protein PHYSODRAFT_255937

Sequence
1416 bases(100 bases per row)
GCAGTACGGGAATGTTTTGTCGCTAACAATGTCGAGGAACAGGTCATGGCCGGTCGTGTACGTCACGTACGCACCGAGGCAAGCACAGACGAGGATGATG
AACGTGCCGATGGCCTTCTCGAACCAAGGAACGGTGTTCCAGAACACCTTGAGGTAGAAGAAGATCGGCAGGATGATGCACGCGAGAGACACAGCCCAAG
CACCAACAAAGTCCGAGAAATCCATGAAGTGGTCCTTGAAAATAATGGCCAGGATAAGTAGAATCACCACAACGCAGATGCGCAGCGTCACGTACTTCAT
GATCACTACGGGTCCGCTGTTGTGGCATTCGTGAAGAAGAGCTTCCGGTGTCAAGTCGTGCTCAGCATCAGCCATGGACGTCGCTGAGGGACGACCGTTA
ATGATAGGTGTGCCTTCCTTCTCGCCGACACGCCCTTGCGGAGTGTTGATGACATTGAAGGCGGGAGATTCCTCATCAATTGGAGGCAATAGAGGACGTT
TGTGCATGCCCAGAATGCCGCGCTCAAGGATATACAGCACGGGGTTCAGGATCACGGACATGGCGATGGTAATGTGCAATTGCATGAACATGTATGCAAG
CACGACAGCACCGCGGTTCGCGTTCAGGTTCAGGGCCGTACCGTTAATGGCAAACAAAAGGTTACCAGGGATTTGACAGCCAACGTACGAGTACGAAGTC
TCGCCAATAATCAGGAAGCAGCAGGCAGCAAAGATCATAGTGCAGGCGACAACACGAGGCATACGTTCGGGTTGTGAGTGCTCACGTTGTAGGGCAGGCA
CCAGCACAGCAGCGGAGTAGGCCAAAGCCAGGTTACCGAACGAGCTTGCAGCCTCACTGAACTTGATCTCCGGGTGAGGGACGGATGGGTGGTCATTGCC
AATACCCACAGCGAGCACAGAGATGGCAATCGCGTCGGCCAGCACGGTGCCCATGCAACCAGCAAAAGCAGCGTACGCGCCTTCCTTCAGAGTAGGTGTC
ACGATTACAGGCAGCAGCATCACAGCCATGATAATGCTCCAGTACTGTGTGCCGAAGGCATCTGGAGAGATACCGTCGAGCAGGATACCACCCAGAACAA
GGTAAGCGCACGGCACGAGGAGGCAAACGCCAAACTGCGCGAGCAGCACGAGATAGCGTCCGATCTTGCCACAGCACCACTCGCCGATATCACCGTAGGT
CTTGAGGTTCTTGGGAGCCGCCAGACACACTCGGGAGATGGCGACACATGAGCAAACGTTGGCGAAACCCATGAAGAGTAGTGCTACCGTGGCGATTGGG
GCACCTGAACGAGCAAAGTTGGCCGGAAGACCCAGCGTTCCGATACCGTACACAGTACAGAAGAAGCTGAAGGAGATCTTGAAGTCCTCGAGTGTGAAGA
ACGGCATGGTTGTTTG