Description :
From Genome Similarity Track
Location :
contig_86:143788- 148857
Transcript NameFunction/comments
g12911.t1hypothetical protein
g12912.t1hypothetical protein

Sequence
5069 bases(100 bases per row)
TGTTTTGCGAGTGCATGGAGTGGAAGCGCAAAGAGATAGAGAAGAAGTGGAGAGAGCACGAGGATATGGCACCTGCTGTGGACTGACAGCACCACACGTA
GCGTATCGTATCACGAAATACATTGTGCATGTAGTGCCTTAGGGGAAGAAACGCAGCGCCAAGGTATCGTACAATCAAGAGCGCTGCACTATTTGGGTTT
GCAAGCCAGCACACCTCGGCATGATAGCATTGCGGGTGAGTTTATTCGCTGATCTTTCGGGTTCAAATCCTGCGTTTTTCGCCTTGAAGTTGTCCTGATA
ATGGCTCATGTCCGTTTACCAGGGCAGCTCGGGACCTTGGAAGTCGTAGAACTTGGCGGTGTCCTGGAGCGCGACGCCGGAGAGGACCTTGGTCATACCG
GCGATGGAGTCCTCGGGCTCCACGGCGCCGTGGCCATGGTTCAGGTCGGTCTTGACGAAGCCGGGCTGCAGCACGATCTTGAACGGCGAGAGCGCCTTGA
GCTAAAACAACGAGGAAAGAGGAGTTGGGTTAGTAAAGCAAAGAGTTCTCCAGTGCAGAGGGTGAGTCCGTACATCGTGAGGCTACGCTGAAAAAAAGTC
TTCAATCGAGCGTCTTAGTGCATGCTTCCACAGACACCGACATCCAATTTGTTGGTATAAAGTCCAGGACCTGGTACGACGACAACGAAGCATTGCCTCG
CTGTATCCAAGAGAATGGGCCGGAATTTTTTTTTGTGCTTCTAGAAGAAGAGTTTGTGTAAGTGTTGAATTCGTTGGTTCACTACAGTGAGGTGTACAAC
AACTAAGAGAAAGTAAATGGTCCATTACATTGTTCAGATACGAGCGATTGACTTTGCTGTTTTTACTGCTGAAGTCCCCAGACATAGTTCGCGAACGACA
TGTGGCCGATTGCCCAGCCACCGAAGAGCCCCTTAGCTCCGGGTTCTTTTTCGTCCATGCCCGCTCCAGCAGCGACAACAAACGGCATGAAGTGGTCGGG
CGTTGGGTGAGCGAACCTCACTCCAGGAGCATCCCGCCAGTTCGTGATCTGCTTCGTGCGCTCAGAGAGAATCAGCTTGGACTCGGAGGCCATCGTGCTG
TCCAGCCAGCTTTGAAAAGTTCTCGCTTCCCTCCACGAGAGCAGAGCTAGAGCTACGGAGACCGCGGAGGTTATGCGTCGACTGCCCCGAGCAAATGATC
AGCGTGTCTTCGTCACGAAAAGGTGCCAGCGCCTGGCCCAGGCCGAAGTGAGTCTGGTTATCCAAGTACGAGTTGATGGACATGGTGACGATCGGGATGT
CAGCCTGGGGGCGGATAAACCTCAAAGGCACGAAGACTCCGTGGTCGAAACCTCGGTTCACGAGTTTGGCCTTGATGTCGTTCTTCTCGAGCTGATCCTT
GACCTTCTGGGCGAAAGCAGGGTCCCCCTTGGCGGGGTAGACCACCTCGTAGGCCTCGTCGGGGAACCCGTAGTAGTCGTAGATCATGTCGGGTTTGGTG
GCGTTGGAGATCTCGAAGCCGCTACTGTCCGACTCGAAGTGCGCCGACACGAACAGGATTCGCTTGGGCAGGTTCTCGCCCTTGGGGTACAGCTTCTCGA
ACAGACCCGAGAGCAGCTCTACCGCCGCCGCAGAGTCTCGCTTCACATTGTTGAAGTCGGAGGAGAGCAACCACAGCGGACCAGGTCCGTGCGAAACGGC
GACTGTGGGGTGGCGGAAGGGGGGCATCGTGGAGACTGGGCGGACTTATTGGGGTGGAAGCAAATTGCTCAATGAGACTGCATGGAGGGCATCAACTCAG
CATGTGAAGCGATAGCGAGACAAACCACCAGGATGGAGGAAGTTCTTGAGTAGTAGAGCTGCTGACTTTGACGAAATGAAAAAATATTTTTAAAAAAATC
TGTTCTCAAAAGACTGCATTACAGTTATAAAGTCTGACGAGTCAAATATCCTAAAAGATGGCGTAATCTGGCTTAAAAAAAAAATGGACACGTCAACCGC
GAAAAGGGGAGGTTAGGTGTACAAAAATGGCGGGAATTGGGTGAGGAGTAGCCAATGATCTGGCGTAATCGGTGATATTACATTTTACAGCTCGCAAAAG
AAGGGAAATTCGAATTCTACACTTTTCTGCTGGCACTGCCAGTCAACGAACTACCATGGGACCAAAATATATCCGACCTCCGACCTTTCCGACCATGTAT
AGAAAATAGTATGCAATACAAAAGTTGAGTGACCCTGTAAAAATATTCGTAAAAAGGTAAATACGTGTTTTGAAATGGATGGCACTGAGCCCACGTGCCC
TGCGCAAATCCGTCGACGCGTGTCAGTGCCCGAGTGACCATCCTGGAGGATGAATTGAGGGAGGTGTGCCGAGCATCGGTGCACTGAAGAGGGTTGTCGC
TGCCACGAAGAACTGTGGTTGGTTAATGCTCCCTCGGGCACTCCAACGAGTATACCCTGCGCTGAGTTGTACTAACCCCACCTTAGTAGCTCAGTGGTAG
AGCCCCCGAAAGGGATGGTCGTTGGGTCCGATTCCCACCTAAGGTATTTCTAATGTTCGACAGCATATTGGCCGGTGCAAGGCAGCGAGTGCGAGCCTAT
GTGTGGAAGTATGTGTCGATGTGTGACAGTACATGTGTTGCGTTGTGAAGCAGTGTGTGTGTGTGTGAACTAACGTGTATTATGCAATTTAAAGTGCTGG
CATATTTACGCACGAATCGGTTCCAATATGTTCTGCGTGTAACCAGGGGCAGGGTCTTGGATGGCAGGTGTCTGGAGAAGCTGTTCGTGGCGCCCAATAT
TGGTGTTGAGTGTTCCAGCACGATGGAGTATGCGTAGGTGCTTGAGGACGGCTCCGGATCCACGGGAGCTGATGTTATGCTCACCAAGGAACGCGAGAAC
AGACTCCTCCGCGCGAGCTCCGAGCGACAGTACCTGATCGCGATAGTTCGGTGCAGTTGGATCAAGCACAAAGCCGTCCTCCAAGAAAAGCTTCATGTAC
GCGACAAGTTGCTTGGCATCGGACTTCTGCTGCTTCGAGATCGGTGCCCGCCACATCCGTGGTTCATGAGCGTACCACGCGTACCAGGTCGCGCGAAGGT
GAGTCACTGCTGATCTGCGCTGTTTCTTCTTGACGTTACTGATGTCGCTTGTGTCGGTGTCTGGCTTGTGTCGTTTGCGTGTAGCATGGCTAGGATTGTT
GTTTAGCTTAGCCTCGAGGGCATCCATGCGAGCATCTTGCCGCTTGACGTGCTGGATAAAATGATTAATGACAGCCGCTTGGTGGTCGATGATCTTCTGT
TCTGCGCTTGGCTCCATCAGCTGCTTGGATACCACGATCTGCTGTTGCTGGTGTGTGCTTTGTGACTTGGTGTCTTCACAGGTTAGCTGTGGGGCTTGCA
AGATGCGACGACCACGCCAGTAACTCAGAGAGCGAGCAGCCGGTGTCAGCTACACAGCCTTCAATGCGCTTGACAGCAGGTGCTTCAGCGTTCAAGTCTT
TCAACAGCAGATAGTGCCGAAGCACACTCGAGGTAAGCACATCCAGAACTGCTTGATTCACGTTGTGTCGTGTGGTTTCGAGATGGTGACAGGTCGTGAA
CAGACGGCGCTGGAAGCTAGCGACCATCGCCCTAGTTTGTGTGTCGAACGTTGTCAAGTTTTGGAGCGACACCTTTGCCTCAGCGCTATGTCCACTGAGT
ATCTTGCTAACCTTGTGATATTCCTTGCTGGTAGTTGAGCCCCTTGTTTGTTGTGCTCATATTCCAGGCACCTCTGTCGAAAATCCACCGCGCCGTGAGC
TCCCCGCTCCCATTGGCATGCTGTGCACCGCCGCGTCTGAAGGAAGGAGACGTCAGCGCAACCTTGACTCCTGCGGCTGCAGCAATTCGGTTCAGCAACC
GGTTCACGTGGGAGTAGATGGCGGGCGTCGTCTCCGCCCCAGCAGTCGACGGTGCATCAAGACCTGTGGTGTCTGTAGGATGATTGAGGATCTCGAGCAG
CGGGACATCTGGGGAAAGCGAGATCGCGGCTTGGCCAGGCAGCTCCGGCAGGTTGTCGATGACGTCGGGAGATGGAGCGGTCTGCATCATCAGGGCCAAT
GCTATCGCGAGCATTGGGCACGTCGTGAAGTCCGTTCCGGGGAAAAGCGACAAGCCCTGCTCTTCGGATGTCTTCATGCGAATGAAGCGCACGAAGAGCA
CATTTCCAGCGTCGATGGAGACATTGGGCTTGCGGAGGAGCGCGAGATCTGAAGCTCGCCCGAACAGGTGCCACAGCAGACACAGTAGCGCAGCATCTTG
GTAGTCACTAGAGCAGCTTGCATGAACATACAAGTACGCCAGCATTCGTTTCAAGTCAGCCTTTGTACATGGTGGTGCCTTGCTAATGAAGCCACCGCCG
TCACGTTTCATACAAAAATTGTCTAGAGTCTTCCCCATTTTGAGCAACCGTGCTTCCAGTGCAGCTCGGTGCTGTGGAAACTGATCCAACAGCCAAAGTT
TAGCTTGCCGATAGTACTGCATCGAAGTGTTCCGTGATAGTGGCTTGCCTTTCTTACCCTCTATGAATGCAAGATGCATACCAAACTTGTCCATTACGGA
CACAAAGCACTTCCCACTCTCGTCACGCTCAATACACACACGTACATACTCCTCTGTCACACCCTCAGACTTTAAAAATCTCATGAATGCTGACACGGCA
GTTGCCTTGGCACGCTTCGTGTTTCCAGGGGCTAGCTCCTCCAAACCCATCCTGCAGGTCGGATCGATGGCAAATATGCGAGTGCTATGCTTTTGACTTG
CCTTTTGAGAGACGATACACATATTTGGCGACTGTTTCCGACGGAACGGCTGGCCTACAGGACTTGCCTTATACGTGTCATGCTATTGGCCAAAATACGG
GATCTAATATACAATGATTGGTTTAAATTGTACACCTTGGCTCCCATTGGCCTTTATGCTCAATACAAACTCAAAGTACAGTCGGATAGATTGTCATATT
CAACCATACGTTTGACACGCGAAGCTCGGATACTTTGCCGGATTTTAGTCCTGAAAGTGCACCTTTAAA