Description :
From Genome Similarity Track
Location :
Scaffold_234:14378- 15637
Transcript NameFunction/comments
g11733.t1hypothetical protein

Sequence
1259 bases(100 bases per row)
ATTGTTTGGTCAAAAAGCCCAGCGCCAACCACTGGCCACCACCGTGGCCAACCAACACTCAATTGTCAATCACCAAGAGACATGGTCGAAGTGACGCTCA
AGAAGGGGCTGCGCAACCCGCTGGACGAGGCCCAAGTGCGCCGCGCCGTGCTGGCGCTGCAGACGTTCGTGGCCAAGAAGGCCGAGGCGCGGTCCAAGGC
GCCGCTGGTGGAGGACGCCGAGTTCGTGTCGTGTATCCTCACGCGCAAGCTCGTGCCGGGCAAGACGTCACTCAAGCCAATCCCAATGTGAGTCTATGCT
TCAGGCCACCTCAATGGCCATCACCATGGCCCACACGAATCGACCTTTTGCACGTGGTTCTGACGCCTGGACCGGTTTGTATGGCCTTTTTTGATGCAGC
AACCTGCCCCACGCCATCTACGACGAGGCGGCCGAGATGTGCCTCTTCGTCAAGGACGAGGACAAGAAGCGCATCAAGGAGGCGCTGGCGGCCAGCCCCG
TGGCCGGCCTGGCCAAGGTGCTGACCGTCAAGAAGCTGCGCAAAAACTTCTCGCGCTTCGAGGACAAGCGCGCGCTGGCCGCGGCCTACGACGGGTTCCT
GGCCGACGACCGCGTGCTGCCCTACCTCAAGGGCCTGCTGGGCACCAAGTTCTTCTCCAAGAAGAAGCAGCCCATCGCCGTGCGCGTGTCCCGCAAGGAC
GTGAGCGGCAGCCTCCGACTGGCCGCCCGCCGCACAGCCTTCCACGTGAGCGCCGGCGTGTGCCACAACGTCAAGGTGGCCCGCTTGGACATGACGCCCG
ACCAGATGGTGGAGAACGTCATGGTGGCCATGAACCAGTGCGCCAACCTTGTGCCCAAGGGCTGGAACGGCGTGCAGTCCATCAGCATCAAGACCAGCGA
CTCGGTCGCGCTGCCCGTGTACAACGCGCTGGCGACGCTGGCCAAGCTGCCGCCCATCGGCAAGACGCAGAACCTCAAGAAGCGGAAGCTCGAGGAGTTC
ACGGCCGAGGTTGAGGAGGAGGCTCCGAAGAAACAGGCCAAGAAGCCGGAGACGTCGAAGGTTAAAAAGGCCAAGGTGGAGGCGCCGAAGGTTAAGAAAG
CCAAGAAGGAGGTCGAGGTGGAGGAGGCGGCAGAGGCCAAGAAGCACAGCAAAAAGGCAAAGAAGGCGGTGAAGGCCCCAGAGACCACGACGCCCCCGAC
CAAGAAGAAGTCCCGGGCCAAGAAAGTGGCCAAGAAGTAAGCTCCTGTCCTCGCAATCC