Description :
From Genome Similarity Track
Location :
contig_86:143766- 148836
Transcript NameFunction/comments
g12378.t1hypothetical protein
g12379.t1hypothetical protein

Sequence
5070 bases(100 bases per row)
CAGAACAAGAAGGTGTTTTGCGAGTGCATGGAGTGGAAGCGCAAAGAGATAGAGAAGAAGTGGAGAGAGCACGAGGATATGGCACCTGCTGTGGACTGAC
AGCACCACACGTAGCGTATCGTATCACGAAATACATTGTGCATGTAGTGCCTTAGGGGAAGAAACGCAGCGCCAAGGTATCGTACAATCAAGAGCGCTGC
ACTATTTGGGTTTGCAAGCCAGCACACCTCGGCATGATAGCATTGCGGGTGAGTTTATTCGCTGATCTTTCGGGTTCAAATCCTGCGTTTTTCGCCTTGA
AGTTGTCCTGATAATGGCTCATGTCCGTTTACCAGGGCAGCTCGGGACCTTGGAAGTCGTAGAACTTGGCGGTGTCCTGGAGCGCGACGCCGGAGAGGAC
CTTGGTCATACCGGCGATGGAGTCCTCGGGCTCCACGGCGCCGTGGCCATGGTTCAGGTCGGTCTTGACGAAGCCGGGCTGCAGCACGATCTTGAACGGC
GAGAGCGCCTTGAGCTAAAACAACGAGGAAAGAGGAGTTGGGTTAGTAAAGCAAAGAGTTCTCCAGTGCAGAGGGTGAGTCCGTACATCGTGAGGCTACG
CTGAAAAAAAGTCTTCAATCGAGCGTCTTAGTGCATGCTTCCACAGACACCGACATCCAATTTGTTGGTATAAAGTCCAGGACCTGGTACGACGACAACG
AAGCATTGCCTCGCTGTATCCAAGAGAATGGGCCGGAATTTTTTTTTGTGCTTCTAGAAGAAGAGTTTGTGTAAGTGTTGAATTCGTTGGTTCACTACAG
TGAGGTGTACAACAACTAAGAGAAAGTAAATGGTCCATTACATTGTTCAGATACGAGCGATTGACTTTGCTGTTTTTACTGCTGAAGTCCCCAGACATAG
TTCGCGAACGACATGTGGCCGATTGCCCAGCCACCGAAGAGCCCCTTAGCTCCAGGTTCTTTTTCGTCCATGCCCGCTCCAGCAGCGACAACAAACGGCA
TGAAGTGGTCGGGCGTTGGGTGAGCGAACCTCACTCCAGGAGCATCCCGCCAGTTCGTGATCTGCTTCGTGCGCTCAGAGAGAATCAGCTTGGACTCGGA
GGCCATCGTGCTGTCCAAGCTTTGAAAAGTTCTCGCTTCCCTCCACGAGAGCAGAGCTAGAGCTACGGAGACCGCGGAGGTTATGCGTCGACTGCCCCGA
GCAAATGATCAGCGTGTCTTCGTCACGAAAAGGTGCCAGCGCCTGGCCCAGGCCGAAGTGAGTCTGGTTATCCAAGTACGAGTTGATGGACATGGTGACG
ATCGGGATGTCAGCCTGGGGGCGGATAAACCTCAAAGGCACGAAGACTCCGTGGTCGAAACCTCGGTTCACGAGTTTGGCCTTGATGTCGTTCTTCTCGA
GCTGATCCTTGACCTTCTGGGCGAAAGCAGGGTCCCCCTTGGCGGGGTAGACCACCTCGTAGGCCTCGTCGGGGAACCCGTAGTAGTCGTAGATCATGTC
GGGTTTGGTGGCGTTGGAGATCTCGAAGCCGCTACTGTCCGACTCGAAGTGCGCCGACACGAACAGGATTCGCTTGGGCAGGTTCTCGCCCTTGGGGTAC
AGCTTCTCGAACAGACCCGAGAGCAGCTCTACCGCCGCCGCAGAGTCTCGCTTCACATTGTTGAAGTCGGAGGAGAGCAACCACAGCGGACCAGGTCCGT
GCGAAACGGCGACTGTGGGGTGGCGGAAGGGGGGCATCGTGGAGACTGGGCGGACTTATTGGGGTGGAAGCAAATTGCTCAATGAGACTGCATGGAGGGC
ATCAACTCAGCATGTGAAGCGATAGCGAGACAAACCACCAGGATGGAGGAAGTTCTTGAGTAGTAGAGCTGCAGACTTTGACAAAATGAAAGAATATTTT
TAAAAAAATCTGTTCTCAAAAGACTGCATTACAGTTATAAAGTCTGACGAGTCAAATATCCTAAAAGATGGCGTAATCTGGCTTAAAAAAAAAATGGACA
CGTCAACCGCGAAAAGGGGAGGTTAGGTGTACAAAAATGGCGGGAATTGGGTGAGGAGTAGCCAATGATCTGGCGTAATCGGTGATATTACATTTTACAG
CTCGCAAAAGAAGGGAAATTCGAATTCTACACTTTTCTGCTGGCACTGCCAGTCAACGAACTACCATGGGACCAAAATATATCCGACCTCCGACCTTTCC
GACCATGTATAGAAAATAGTATGCAATACAAAAGCTGAGCGACCCTGTAAAAATATTCGTAAAAAGGTAAATACGTGTTTTGAAATGGATGGCACTGAGC
CCACGTGCCCTGCGCAAATCCGTCGACGCGTGTCAGTGCCCGAGTGACCATCCTGGAGGATGAATTGAGGGAGGTGTGCCGAGCATCGGTGCACTGAAGA
GGGTTGTCGCTGCCACGAAGAACTGTGGTTGGTTAATGCTCCCTCGGGCACTCCAACGAGTATACCCTGCGCTGAGTTGTACTAACCCCACCTTAGTAGC
TCAGTGGTAGAGCCCCCGAAAGGGATGGTCGTTGGGTCCGATTCCCACCTAAGGTATTTCTAATGTTCGACAGCATATTGGCCGGTGCAAGGCAGCGAGT
GCGAGCCTATGTGTGGAAGTATGTGTCGATGTGTGACAGTACATGTGTTGCGTTGTGAAGCAGTGTGTGTGTGTGTGAACTAACGTGTATTATGCAATTT
AAAGTGCTGGCATATTTACGCACGAATCTGTTCCAATATGTTCTGCGTGTAACCAGGGGCAGGGTCCTGGATGGCAGGTGTCTGGAGAAGCTGTTCGTGG
CGCCCAATATTTGTGTTGAGTGTTCCAGCACGATGGAGTATGCGTAGGTGCTTGAGGACGGCTCCGGATCCACGGGAGCTGATGTTGTGCTCACCAAGGA
ACGCGAGAACAGACTCCTCCGCGCGAGCTCCGAGCGACAGTACCTGATCGCGATAGTTCGGTGCAGTTGGATCAAGCACAAAGCCGTCCTCCAAGAAAAG
CTTCATGTACGCGACAAGTTGCTTGGCATCGGACTTCTGCTGCTTCGAGATCGGTGCCCGCCACATCCGTGGTTCATGAGCGTACCACGCGTACCATGTC
GCGCGAAGGTGAGTCACTGCTGATCTGCGCTGTTTCTTCTTGACGTTACTGATGTCGCTTGTGTCGGTGTCTGGCTTGTGTCGTTTGCGTGTAGCATGGC
TAGGATTGTTGTTTAGCTTAGCCTCGAGGGCATCCATGCGAGCATCTTGCCGCTTGACGTGCTGGATAAAATGATTAATGACAGCCGCTTGGTGGTCGAT
GATCTTCTGTTCTGCGCTTGGCTCCATCAGCTGCTTGGATACCACGATCTGCTGTTGCTGGTGTGTGCTTTGTGACTTGGTGTCTTCACAGGTTAGCTGT
GGGCTTGCAAGATGCGAAGACCACGCCAGTAACTCAGAGAGCGAGCAGCCGGTGTCAGCTACACAGTCTTCAATGCGCTTGACAGCAGGTGCTTCAGCGT
TCAAGTCTTTCAACAGCAGATAGTGCCGAAGCACACTCGAGGTAAGCACATCCAGAACTGCTTGATTCACGTTGTGTCGTGTGGTTTCGAGATGGTGACA
GGTCGTGAACAGACGGCGCTGGAAGCTAGCGACCATCGCCCTAGTTTGTGTGTCGAACGTTGTCAAGTTTTGGAGCGACACCTTTGCCTCAGCGCTATGT
CCACTGAGTATCTTGCTAACCTTGTGATATTCCTTGCTGGTAGTTGAGCCCCTTGTTTGTTGTGCTCATATTCCAGGCACCTCTGTCGAAAATCCACCGC
GCCGTGAGCTCCCCGCTCCCATTGGCATGCTGTGCACCGCCGCGTCTGAAGGAATGAGACGTCAGCGCAACCTTGACTCCTGCGGCTGCAGCAATTCGGT
TCAGCAACCGGTTCACGTGGGAGTAGATGGTGGGCGTCGTCTCCGCCCCAGCAGTCGACGGTGCATCAAGACCTGTGGTGTCTGTAGGATGATTGAGGAT
CTCGAGCAGCGGGACATCTGGGGAAAGCGAGATCGCGGCTTGGCCAGGCAGCTCCGGCAGGTTGTCGATGACGTCGGGAGATGGAGCGGTCTGCATCATC
AGGGCCAATGCTATCGCGAGCATTGGGCACGTCGTGAAGTCCGTTCCGGGGAAAAGCGACAAGCCCTGCTCTTCGGATGTCTTCATGCGAATGAAGCGCA
CGAAGAGCACATTTCCAGCGTCGATGGAGACATTGGGCTTGCGGAGGAGCGCGAGATCTGAAGCTCGCCCGAACAGGTGCCACAGCAGACACAGTAGCGC
AGCATCTTGGTAGTCACTAGAGCAGCTTGCATGAACATACAAGTACGCCAGCATTCGTTTCAAGTCAGCCTTTGTACATGGTGGTGCCTTGCTAATGAAG
CCACCGCCGTCACGTTTCATACAAAAATTGTCTAGAGTCTTCCCCATTTTGAGCAACCGTGCTTCCAGTGCAGCTCGGTGCTGTGGAAACTGATCCAACA
GCCAAAGTTTAGCTTGCCGATAGTACTGCATCGAAGTGTTCCGTGATAGTGGCTTGCCTTTCTTACCCTCTATGAATGCAAGATGCATACCAAACTTGTC
CATTACGGACACAAAGCACTTCCCACTCTCGTCACGCTCAATACACACACGTACATACTCCTCTGTCACACCCTCAGACTTTAAAAATCTCATGAATGCT
GACACGGCAGTTGCCTTGGCACGCTTCGTGTTTCCAGGGGCTAGCTCCTCCAAACCCATCCTGCAGGTCGGATCGATGGCAAATATGCGAGTGATATGCT
TTTGACTTGCCTTTTGAGAGACGATACACATATTTGGCGACTGTTTCCGACGGAACGGCTGGCCTACAGGACTTGCCTTATACGTGTCATGCTATTGGCC
AAAATACGGGATCTAATATACAATGATTGGTTTAAATTGTACACCTTGGCTCCCATTGGCCTTTATGCTCAATACAAACTCAAAGTACAGTCGGATAGAT
TGTCATATTCAACCATACGTTTGACACGCGAAGCTCGGATACTTTGCCGGATTTTAGTCCTGAAAGTGCA