Description :
From Genome Similarity Track
Location :
Scaffold_101:143766- 148728
Transcript NameFunction/comments
Hyaar_Emoy2809446conserved unknown protein
Hyaar_Emoy2809447hypothetical protein
Hyaar_Emoy2809448hypothetical protein

Sequence
4962 bases(100 bases per row)
AGCGAATTGACTAGCAGGCTGTCAGTACTTTGCGGCGAAAGCTGGACGGACAAGCTTCGCACTGCATTTAGCTTGTGTGACATAAACTCCGACGGACGCA
TATCGCTGGGTGAAATGCGTTTCTATCTCGCTTTGGTGTTTAGAGTGCTTTTCGAGGTGAAGCTGGACAAGGAGACACAAATGGGCGTGACGCCTGAGGA
ACTGGGCGAAATTACAGCAGAACAAGTTTTTGCTAAAGCAGACCTCGATAGGGATGGTAGTCTTACCTTCGTCGAATTCAGCCAATGGATGGTCCAGCAC
CAGGTACCGGATGTAGTAAACTTAGACGTTGTAAAAGAGATGACAAATCTGGAAAAGTTTACGGCAGATGAAGTGTTCGAAATTCTTGCAAATCGTTGCT
CAGACGATGGGACGCTATCGCGTGAGGTTTTCGAGGAGTGTTTCGAGCAGCTTGTGGACGAGCAGTACAAGAATGATGAGACCAGCCTAGCGCGCTTACG
ACTTACCCTTAACAGGTTGTTTGTCATATTCGACGAAGGCAACAACGGCAGTGTCAACTTCTGCGAATTGGGCAGCGGTCTGTCAGTTCTTTGTGGTGGC
TCGCGGGAGGAAAAGGTGAAGGCTGCGTTTTCGCTTCTCAGTCCTGACCACGATGGGTTTGTTTCACTGGACGAAATGGTACGCTACCTGGTGAGTGTTT
TTAAGGTACTATACGAGACCAATCCCGGGATGTACGAAAAGGTTGGTGTCCAACCGGACGAGATGGCCATTATCATTGCTACACAGTGCTTTTCGGAAGC
GAATCTTAACGAAACCGGTAGAGTGAGTTTTGACGATTTTGTAGCTTGGTACTCTACAATGCCCAGATTCGAAGCGTCTGTAGCAGGCGTGGGTACCAGT
TTTCTTGCCGGACAACAAGACGATCGACAACGGACGAACGGTGACATGTGCGTGAGGCATGATAGTGACGATATAACTTCACTTCAACATGGTAAAGATG
GCAGCTGTCATGATGGATCGCCGCCCGAGTCCGTGGTAGACACGGTGCTGGGTACCGGTAAAGAGCCTTACTCAAGGAACATTAATACCGCACTTGCAAA
CTTCCCGTCCAATAAGATCTGCGGCATGGCGGGATCGAATGGCGATGCGCTCCTATCCCCCAACTCAGCGTCTGCGCTGAACATGAATAGCTCAAATATG
GAGCACGTCCGGCAGCTTTTGAAGTTGGACACGTATGAGGTCAATGACGTGCTTGAAATATTTGCTGAAGCTTCACCATCTGGTGAGCTACCGTTCGTAG
CATTCAAAAAGTGTTTCGATCAGATCATACGACTGGCAGGGGGGCACGATTCCCCGGAAGAACGCCATGAAGCTGATGCGATGGTCTATCGACTCTTTCG
CGTGTTCGATTCCGACAACAATAACACTGTCGATTTCGGCGTGCTCGCTAGCGGGCTCTCGGTATTATCAGGATCCAGCATGGATGAAAAGGTTCGAGCA
GCGTTCCAATTGCACGATATCAGTGGAAACGGGTATATCACACAGGAAGAAATGGCCAACTACTTGACGTCAATTTTCAAAGTGATGTATGAGACGACTG
ATAGCACGAAGACCAAGATGGGCGTATCACCTGAAGAACTTGCTTGTGCAACAGCCAAGCAGTGCTTTGTGGAGGCGAGTCTTAGTGGAGACAACAAGCT
CAGTTTTGAAAAGTTCAAGAAGGTATGAGTAGTCGAATGGTGATGGTATTGTCTGTCATCACTTGCTTGTGACGATAGCTAATGATGACTATGTTGCTTA
TGACTATCGCAGTGGTGCACTTCAGGTCTTTGAAGAGGTCCATGCGTACTAGGAGTAGTAGCGGAGCTTGTGAACTAAAACGTTATGTATGCTTGGTAGC
CTATAACCAGTCTACAAGAAAACCTGAATTTCGTCATCTCGCAAGAAGACATCATCACCAATATCGACGTCAATGTTCATGTCACAGGCGAGTTTATCGA
TCCCGATCCTTCCCTCTTCCGCCATGAGGTCCGTTAATGCGTCAAGCAGACTTTCGCTGATGTTGGCTGCAGTTGCATACGAAGTGGTTGGACTTACGGT
GTCTCAAGACAATTTGAGGAATCGCGTACACCGTACCATGAACGTCAAGTAAACGGTTGCGAAACTGCTTCTGCTCAAGTCCCACACGGTCGGTAAATTT
CTGAACAGCGGCTGCTCGGGTAAGAAACTCGTCTTCCTTGTCATCGTCCTAGATCCAGCCGTATCCGCCAATGAATGAAAACGCGTGACAGGGGTACAGC
AAACGAGTGCAGCACATACCACAATACACAGAAGCTTCATCGCAAGATCCTCCTCAATTTCGCTAGGTTGCTCGAAGCATCATGCACATTAGGATAGTTT
GACCATCGGAAATGCAGTGTAGGGGACAACTTACTCTTCTGGAGGAGAGTGCAAAGCCTCAGCATGTGATAGCGTACTGTTCATCGGGCCTGCGGATGCC
GAGGGCGCTTCCTCTAAATTCGTTACGACCTTACTGGGATCTACGCTTTGACACGCGTCAGAAGGTCTCCTGCTTGAACAACACCAAGCAAGTCATCATA
AGACACTTCACTAACGTTCGCTTCAGAGCACGAAAGCAAAATGGTACCCCGACTCGGCCACTTTGGTATCCTGAAGCGGCTGCACTGCTACAACTGCACA
ACTTTACATCAGATATTACAAAGTTAACACTTTCTGATGATTGAAAGCATACCAGTTTGAGACGTCCGTTTGCTTTTTTTCAGCGCTGGACCCGCTTTCG
ATGAAGCCAGCAGCAGTCTTCGCTTTCTGAGCACGACATCGTCGTCTGCCTTCACGCCCATTCCATCCGTGTCACCCATTTTCATAGCAAAAGAGATGCT
GCTTCGATTGCCATCCTTTTGTCCGACGTTCTCAGCAGTTCCAAGCCCAAACTGTTTGTCTCCGTCCTTGTCTTTGCTGAATGCTGTGCTCTTCAACATG
GGACCTGCGATACTGCTACGAACGCGTCTAGTTTTGCAGAAAAAGAGATCCGTCCCATCTTCTACGGCAACTGCCTCTGTTGCCTTCCTCTTTTTAGCGG
CAGACGATTTGGTGTCGGCTCGAAACGTAAATGGCATTCCGCCTTTTGCTTGCAGCTTGAACAACGGCGCTTTGTCAGCTTCATTTGCACGACGTACGGT
TCTGTTTGCAAAACTCTGGACAGAAACTTTGTTCAGCAGCGGCTTCGTACTTGACAGCGATAGTGCTGTCGCCCCCTTGACAAAAGGAGCCTTCGTCAAT
GTCCCAAGTTCCTTCGACTTGGACGGAAGTTTCAAGAGACTGAAGCCCGAGCTCTTCTTGGACGAGTGGTCAACCTTCAGCAGCTGGGTAAACCTGCTAG
TTCCATATGCACTAGACATTGCGTTTTCTGCAAGTAGATGCAGCGTTAAGACTGAGCAGCACGAAGCGAAAAGAGCCCCACGAGACTTCATTGTTCTTAC
TCTGTTTCTCAGTCGAGCTGCTTGCTGCTGCAGGCTTGAGGAACTTGGCCTTAGGCTTCGTCTCCAAACTCGATTGTTTCTCTGTGTGCAGCATAGCCAC
ATCCTCCTTATCAAATCAAATAAAGGAATTTTTTTCCATAAGCGCGCACGTACTCGTCAGCAGCGGCAACGGCAGCAGCGAATCTTTCGACGTGTGCAGC
TTGAACTTGCCTAGGAACGGGGCCACGCCATGCTTGCCCGCCGCCGCCACAGCAGCAGCGCCTCCATTTCGGAGCTTACTACTAAGACGATCCATGTTTG
CGTCTTCCTTCGCCTTTTCGCTTTGGTGTCTGACGCTGAACATTAGTATGTGAGGATATATGTGGTAATGGCAAAAGGGAAACTTCAACGTTGCCGAGCA
AGAGTGATGGTCAGGGAAACCGCATCACAGAACATTGGTACGTGAGGATATATATGGTGACGGCAAAAGGGAAACTTCAACGTTGCCGAGCAAGAGTGAT
GGTCAGGGAAACCGCATCACGCGCGCTGGCTTCGATAGTGGCCAATGAGCGCAAGTTCTACTTTTGCACCAAACAAATCGTCGACCTGTCGCAAGTTGCG
AGACCGCACCTTTGCGCGGAAGTCCTTGGGGCTGAGCGACGCCAGTGAGTGGTGACGGACAAGCAACGCGAACAGACGCTGGTACGTCGAAGGGTCCGAC
GACTTCAGGCACTGCTGTAAGAGCGCGATCAAGAGATGGTCCCAAACAAAAGCAGCGAACGCGTCACTGTGGCAGTGCTCGAGCATCCAGCAGACGTCGA
CGATATCCGGCACCTTTGTAGCTCTAACGCCAATCATTTCGTTGTCCTGATCCAGTTTCTGCTTGGGTTGTTGTAGACTCTGGTATACATAGATCCAGTC
ACTCTCCGTCAAGGCGGCCCACTGATCCACGTCTTGTAGTGACGCCTGTCGCGGGTCGAAGAAGTGACTTCTTGCGCTCGCACGCACTTGATCTAGTGCC
GTAGCTGGTAGTGATGTACCTGTTCCATTCGTGTTACTGCACATCTGCGGCGATGGAGATGACACGTCTACGAGGTTCTCTAACGATATATCAATTGGAG
GCAAAAGACTCGCGATCTTAAGCTCGACTTGTGGTAGCACAAACTCATGCTCGATTAGAGTGCGGTCGTGCCGACGTGGTTGCGGCCCGCGTTGTCGCAC
GAAACAGAGTTGCAGTACCTGGTCGGGTCCGAGTCCTTCTTGGTAGAGACTGAAAATGCTGGGGACTCCTGACGCAGACGTCGCAGCGGCGTTGTTCTCC
GCGTTCATGCTTGACACGTGCTGCTCGGATCCTTTGTTCTCGTCCACTGCTGTTAGCAATGTCACACTGGTCATGAAATTGACCTATTATCGGTGGCTGT
ATTTCCGAGTTATATCACGTACTGTGGTCCTTATTAGCTAGAGCCCCTCACCTTCGTCTTGG