Description :
From Genome Similarity Track
Location :
Scaffold_66:143740- 147764
Transcript NameFunction/comments
Physo_138729hypothetical protein
Physo_138730Short chain dehydrogenase family protein

Sequence
4024 bases(100 bases per row)
TTGACTTCTTCTCCTTGTTGCACCAGATCGCGAGCACAACACGTCCGTAAACCACAACTTATCGCCTGGGTGACCAAGACGACTAAAATCCAGGTACCGG
TTGATGCGCTGGAAACGGCGAACCCCACGGAATCACGATCATAAGATCGAGAGATTCAAGATGGGATCAACATTTCCACTTTTCCCCGGTCACCAGCGAA
ACAAGGGCTAAATGCATGTCCGTGTCTTCCTGTCGGCGCGAGTGATAGCAGCGTCTTCAGCTTCTTCGTCGGCGTTTTCCTTCTCTTCTTTGTTTGATGG
AGACGAAAAGGAATCAAGCGCTTCAGGTGGGGCTTCGTCAAGTACCAGTGACATCACCGAAAGACCCGACGGTACATTCCAGCAGCCCCTCTTGGACGCG
GAAGACTGGTTCCTTTCCAAGCAAGAAATCACGGCCTCGAGAGGCGGTGTGCCAAGGACGGATCTGTCAGTCTACACGACCGGCAACAAGGTGACTTCCT
ACACGGCCTCGAACGAATTCTACAGCGCGGTTTACGATGATCTGAGTGCGACCAAGGAAGGAGACCACGTTATGCTTGCTGCGTGGCTCACAGCTCTCGT
TCCCCTGAAGCCAGACGTGGACCCTACAGGCGCCAAAACGGGCATCAAGGAAGTGTTTGCAGGCGTCGTCGAGCGAGGAGGCAATGTCAGCGTCCTGAAC
TGGGCCAGCATTGCGGGCGGATACATCCCTTTCAACATCAAGGCTCGAGACGCAATCAACAGTATTCCTCCGTCTAAATCCACCGGAGCCAGAGCGACGT
TCCTCTTTGACGACCGCGTCAATATGATCGCTTCGCACCACCAGAAAACGCTAGTGATCGCGTCAAGTCGCTCCTTGGGGAAAACCGACCAGCCCGTTGC
GTATGTGGGCGGGTTGGACATCGCGAATGACCGATGAGACACTAGTTACCATAACAGCACAGCCATTCGTGACGGGGGAGGGATTACCTACAAGAACAAG
GGCTGGGTCGATGGCCACATTCGCATCCACGGCCCTACAGCCAAGGATGTGGCACACAACTTCTTGGCCCGATGGAGCTCAAAATACCGCCTATGCCGGG
TCTTGACGACGACCTTCTCAACTTCAAAAACCCGCCGTACGAAGACCTTCCACCACTGGGCTACACAAGCAGAGCGTGCAGATCACACGAACCTTCAACT
GTGAGTACAAACACTACAAAGAGTTTGCCCCGAAGGGAGAAAACTCGTTGTTTCACGCCCGAATCAAGGCCATCAAGAACGCCAAAAACTTCATTTACAT
TGAAGATCAGTACTTTGTGCTGGTTCCGGAGCTGCTAGACGCTCTGATGGAGGTGATGCCGAGAATCCAGCGCGTCATTGTCGTGACGAAAGAGCAGACG
AATGCGTTCACGAACGGAGGGGTACATCAAGTACCTCTACCAAAACGTTGAGCCCATTCGATCTAAGTACCCGGACAAGTTCGAGATCTACACCACCAAG
GCGGACCGGAAACTGCTCATCCACAGCAAAATCGTGATTATCGACGACGTGTACCTGTCGATTGGCTCGGCGAATTGGAATCGCCGTAGCATGACTGCCG
ATTCTGAGCTGAATGCCGACGTCGTGGATACTGATACTGTGAAGTCTCCCGACGGAGTAATGGTCGGCAAACTGCCTCGTGATTTCCGCGTCCGTAAGTT
TTCGGAAATGACGGGGCTGAGCTACAAGAAGATCACCACTATGACGTTCACCAAAGCTGCGGACCAATTCGCCATCGCCGCTGCCAAGAAGTCAACGATC
ATTGCTCCGTTGAAGTCGGAGCACCACGCGTACTTTATCGCCATCACCGACGCCAAGAGGAAGATCGCAGACCCGCAGTACACGTGCATCGCCACCAGTA
GCTAGAATAAGTTCATATTGTCATTTCCATTTTTTTTGTTTCTTCCTAGAAAATAATGTTGTGGTAAGAAAACATTTTGTCATTCGATTGATACTAACGT
TGCGTTCACGGGTCAACTTGGATGGTCGTGTAGTTGATGATCCACTCCTGCATAGCGCGTGGCATGTCCACCGCTTTCTGCTCTACTTCGTCCCAGAGCA
GCAATTTCTTGTCCTCCTTGGCCTTCCTCTTCGCTTCGACCATCGTGCCGTATCTCTCCAGTAGGTGATCCAGGAACGCCTGCGGTGGCTTGACGTGGTG
GTGGCTCACATAGTGCCAGTATCCCTCGGGCCAGCAGTAAACGCCGTCGGTCATGGTGCACGCGCCCATGACTCGAGGCTGCTCCAACGCCAGCGAGCAG
TTCGGGAACCGGCAGAAGCTGTAGGCGAGCTCGTGGCTCTCCACGAACGCCCCGCGGGTGAGGTACCACTCGATCGTCTTCAGCAGCGCCGGGTGACACT
CGGCGAACCAGGCGTCGTCCACCAGGAGGAGGGGGTTCGGTCGGTCGGCGTCCGACGCTCCACCGCCGCCGAGCTCCTCCTCCGAGCACCAGAAGCCCAC
CTCCTGCAGCATTGTCGATGGTGAATCTGCCGTGTCTCGGCTAGGTACGGTCTCAGTCACCCGCCAGGATGGCAAACACGAAGGCGCGGACACTGTCGGC
TATGCGCTCCGGAGCCGGACACCGCACCTCGCAGCATGATCGCTTGAACTGTCGTGTGGGTGGGCCTTAGACAGTCGGCATGACCTTGACGAGGTCGGAG
GTGGTGGTTGAACATGCGTGTATTGGCGCTGGTACATTCGTGCAAGCACGATACAATCATGATTTGTATTGGGAATTTGTGGTCAAATATGAGTAATGCA
ACATTTACACTTAGCTTTTGTATTGCATATTATTCTTGCTAGACTGTAAATTGCCAAAATAATTGGGAAAATGTTGGGATACACACGAATCGATCGTGAT
TGGCTAAATTCATTGAAGATCTTGTCCTGATTGGATAGATGCAATGACAGAGAAGCGCAAGGAATGCCAAGTTGGGAGAAAGCTTCCTTATCCTACAATA
ATACAATACGTCCAGCAGCTCGTTCTTCTGGGGCTCACCAGTCGATCACATCGCCCTTTCCAAAGTGGAGAAGCTGCAACGGGTCTCCAATCTTAGCACG
AGCAATAAGCCTCGCCATCCCTTCAACACTTTCTTCAGGTTCCACAGCTCCGTTGAAGTTGGAATACGCAGTGTTCACGTTGCCCGGGTGGAGCAGCAGA
CATCCGATGTTCTGCGGCTCCAAATCAATCGCCAAGCTCTTCGTGAACACATTCAGTGCGCCTTTCGAGGCGCGGTGTGCGTACGCTCCGCCCGAGCTAT
TATCCGAGATGCTGCCAATCCGCGACGTCACTTGCGCCACAAAAGCGCTCCCTCTCGCGCTCACCGCCAACTGCAGATTAGGCAGCAACGCGCGCGTGAC
AAGCAGCGGTCCCAACGCGTTCACCTGAAACTGGCGCACACAGTCCTCCGGCGTGGTCTCATCCAGGTTGTGCATCCCAGTTGTACCCGCATTGTTAATG
ATCAGGTCGATACACACGCCATTCAGCTTCCTCGCCATGTCCTCAATGGACTTTTGCTCCGCCACATCCACCTGCACCACGTTCCACACCTTTAATCCTT
TCAACTGCTGCTCAAAGTCCACACCACGACCAACAAAGATTAGACTACCGAAAAAATAACAACATCGATAAAAAAATAAAGTGCCCACGTCACCTCCTTG
GCCTTGTCCACTGCTCGCACCGCCGCGATGACATTCCAGCCCTCCTTCAGATAATGCTTCACAAAGGCGAGTCCGATGCCTCTGCTCGCCCCGGTTATCA
GTACCGTTTTGGTGGCAATATCACTCGTAACCTCCGTGAATCTCGGACTCACGTGGACTGTCGTCGTCTCGAGGTGGACAAGTTGTCTGCCTGGGGTGTC
CCTCGCCAAAGCCAAGTGGTCCGTCACGTCGGTGACTGTCCTCTGAGGTCCATCAGCTGTTGCAAGACCATTGTCGTCTACTCTCCGGTGCCTGAACTGG
CGGAAGCGGATGCCGTGGCGCCCC