Description :
From Genome Similarity Track
Location :
Scaffold_134:14373- 17152
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_134-snap-gene-0.21Protein phosphatase 2C

Sequence
2779 bases(100 bases per row)
TTGTCGCCTTGTGTCTACGTCGCCGCGNNNNNNNNNNGAGATCTCACTTGCTGGTGGCACTGGCGTCGTGACCTCGTCTCGACTGAAGCAAACAATCACG
GCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGCACGCGTGCTGCACGTGGCCATGGAGCGCGA
GTTTCTTGCGCACAAAGTCGACCACTTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGCTCGACGA
CGTCTGGTGTCGCGATCACGAGGTCGCCCTTGAACCGGTTCTTGAACTCTCCTCGACCAGTCTTGAAATCAAGGTCGCCAAAGGCGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGCCTCGCTGAACGCGTACGTGAGCGCAGTCTTCATGTCATCA
CGAGGCGAGTTGCGCATGCGCTCAAAGATGCCGCCGTGAAGCTCTTTAGCGAGATATTCGGCCACGCATGAGCCACCATGGCCGTCGTACACGCCAAAGT
ACGCGACGATGTCGTCGCGGATCTGCTGCGACACGCACACGAGGCGATCCTCGTTCTCCTTACGTTTGCCGCGATTCGAGTACGCGCCGACGCTCAGACG
CAGCGTCGTGGTGCTCTTGCCGTCGTCATCGACGACGACAAACGGGCCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCTGCGCGGTGTCGTCGCCGTGCGGGTTGGTCGAGTGCACCGGATGCGA
CTGTGACTGCGACATGTCGAGGTGCTCGAGCACCATGCCGTGCTCAGCGAAGATGCTGAACACGTCGCGGTGACTCGACACNNNNNNNNNNNNNNNNNNG
GCGTTCGGGTCTTGCTGCTTGCTGTGCTGCAACAGCAGCTGGCTCAGGCTCAAACGCGGGCGCGCGTTTGCGTCAGAATGCGAGCTTGGTCGAAGCGCCA
TGTGCTCATCCTTTGAGTGCTGGCAGCCCATATACTAGTGCGGCAAACAAGTGTTGTTTGCTGCAAGGCGTCGATTTAACTGGGAGGGGAGAGTTGCAGG
CGCGGGCGGCTGCACATACACAGAAAATAAAATTGGTGGGTGACATATATGCACATGGTGGCGGTCAGCAAACGCACCCAATAAAGCACGCAACAGTGCA
GACACACGCATAACTTACACACAACACACTGCCAAGTTGCGACACACACACTTGCTAGTTGTTTAACACGAGCTTGATGAGTACTTGCACACGACGTGGC
AAGTGCAGGAGTATGGGGCTTGCGGGTGGCGAGACGGCAAGCGCGAATTCCAAATGCTGCGGACAGGAATAAGTTGCCTGTACACTTTTTTTGAGCGAAT
TGCGAAGAGGCACGAATACACAGAGAGAGACTCAACACGCACGCGGTTGCGGTTGCTGCTACTGCTTGTATACTTTTTTTAGAAAGCTTGGCGCTTTCCT
TTCCGCGTCTGATAGCTAGGGGTGAAGTTGGGAAATGCGGGCATCGCTTCGTCCAAACAGGGAAAAAAGAGGAGGAGCAAGTAAGCAAGTAAGCGGACGG
ACGGACGGACGCAAAGGGGTCGGGGCCGCTGGGGACAGAGGAGGAAAAGGGCAAATAAGAGACTGACTGATATGGAGCAAGCGAGAGCGACAGGGGGACT
GTTTTGTTTGGCTGAGCGAGAGGGGCACGACGACGCACGACGATGGAACTGGAACCCTAATTAGACGATTTCGACCAATCACTCGCACCGGATCTTTGTA
CGCCATACAAACCACGAGAGGGTTAAAAATAGGGGCAGCAGCTGATTGGCTTGCTTGGAGCGCTGGCTCCTCGCCTGCACGACAATATTTATTATAACAA
CGTCACTATGATACGACTCATGCATTGCGTAATGTCGCCTATGATGGCAAGGTGATGGCAAAATCCATGGGGGCAACGAGGCGGCAACACGGCAAAACAC
TCTCGCGGGTTCACTCGCCCATCTGTTTCCGGTACTGTATGGTAGATCGCTGTCATCGGTGTTCATCCAAAGCCCCCTGTTTAATCCGCCGTGTCGCTGG
CACAAGCGGACGTTTCTGAAGCCGTAAGTGCTCTGGCGTGACTTCCAGCAGCAGTGACAGCTCACTTGACTGATCCGCCGGATGGTGGAGCGGAGATTAC
CCCTATCCCCTCTTCAGTCGCTTACCAGCCGCACCCCTGCCCGAGCCCAAGAGTGTGGACGAGCAGAAGGAAAAACAAGCAAACAAACAATTTTACCAAC
AACCGTGCAGGTTTACGACGATACTGTACTCTGCGAAATATACTGAGAAATGCACGATACTTGCACGAGGGGGTTCTGCTGAACAGCCCACACTTTTTCC
AGGAGCTTTCCGCATATTTCTCGCTTCCACTTGCATGGCGGATTATTCTACAATTCCAATTCCATTTGCCACAAAACCC