Description :
From Genome Similarity Track
Location :
Scaffold_783:1437- 3032
Sequence
1595 bases(100 bases per row)
TGCATATTGTGAATGACGACTCGCCGTCGGAGAAAGCTCCTGCTCACTTGGGGGGGGGTTACTGTCATTCGGCATGTTTGTGTTTGCGTGGCACGTCGGT
GGATGGTTGGTTTATAATCGACCGTAGAGTTGCCGTCGTCGGAATTGCCGGACCCAATGTCTGCTTGCTTGTATGCACGAGGTACATGTTGTAATCGCTA
CACCCCTGCTCAGATTAACTGTGTAGTTGTGCCATGTACAAGTCCAACACAATGATTGGTATCAAGATCTTATAAGTAGTGGCTTGGTTGCAGCCATTAC
AGTGTACCGCCAAGCGGTATGGCAAGATGTGGTATTCCGACGGCGACGAGGTAATTTTTTAACAACGCATAACGCGATAATGAGATACTTGTTAAACACG
CCGGAAGATAGGCTTCCCACGTTGTTGCCTGTGAAAATGGCATTGgtcttgcagctgcaacaacgaAAAGGCTTCATACGGGTACCATAATTGGTCAAAG
CTGACGAGTAGAAATTGCTCCCATTTAAAATTGTGATTGGGTATATATTTATATTAAAAAGTAAAATAATAATACCCATATCTATATTTAAAATAAAGTT
AAATCTAGTAAAAATAGTACCCAATCACAACTTAAAATGGGATCAATTTTTAGTAGTTACGGGACCAAAGCCGAAGTCAACATTGTAAGTGCCAGTCGGT
TGGTATGTGATTTACTGCATGTACTGGTCGGAACTTGTGACATTGGTGCGGAAGGAGACAAAATCACAATTGACTTCCCTTCCATCCGTGAGTGCATCGC
AAGGAATTTTCGGTAAAGAATATTTTCAATTTCGTCCACtacatcctcatcatcagGATCATCTTCGCCGTGACAGCGCCATCGTCTCGATCTTCCATTT
GGAGTGCCGCACAGTTTCCAACTCCAACGGATTTACCCTGGCGACTGTGCGGGAATTCACCACACTGTCGCACAACGTGGTGAAGGTGGCTCTGTTGCGT
TCAACCAGTCGTATTGATAACTTCAAGATCGGACAGTTCGTCTATCCGAATTCCTCACCATCAGTTCGTCCCCTCGCGCCACTTCCAACACGCTCTCGAT
TATGCTTAAGTCTATCGGTGACTTGACGATTCAGCTTGTCATTTACTCGGAAGACTGCAAGAGGAACAATGCCTTACCCGCAGTCTACCTGGAAAGCTAC
TACTGCGTCACTAGAAATGTACGGCGTGAACTCGGCCGTGCCTCTCGTGGGTGGCGGCATTCGTATCACACCATTGTTCGCCACCTTGAGAGACAGCTCC
AACAGAGCGAGCCGCTGCACCCAGAAGGTGTTCCTTATAATTATACTTCGTGAGACGTCGctactggagaagatcatTTGCTACTGATGCGGGTCAAGGA
GCTCGAACTACAAGAGTAATACTTCAGCCTGCACTTCAGTCACGCGCTCACTTACTAATGAACAACTGGCCTAGCAGCCATTTGATGACTGTACCATGGA
TACGAAGCTGGGTGTTCAACGCTCGCTCACGCAGTTAGTGACGTTGATCACTGGTTCACACGACAGCATAATGAGGATCTTTTGGGATCCGGGAT