Description :
From Genome Similarity Track
Location :
Scaffold_28:14367- 16886
Transcript NameFunction/comments
Phyta_totarag1486hypothetical protein PHYSODRAFT_479825
Phyta_totarag1487hypothetical protein PHYSODRAFT_482812

Sequence
2519 bases(100 bases per row)
ATTTGTGTGCCAGCCGGCCTGTCTCTGGACGGCAAGATCAGACTGGGCAATGCACACCGAGTCGATAACGTCCGGTTGTGCAGCTGGAGACTGCTGTAAC
CAAGCTGGTCACTGCAAGGGCCCCAGGTGGAGTGTTTGCCTTCTAAATAGGCCACCTGCCATCGCTTGCTATAGAGAGAGCGCATTGAAACTCACTCTTC
TCTGCGTTGCTTCCGCCGCTGGCGCTGCACAGCTTCGTGATTGACGAGCGCGGCGCACTATCGTCCGTATCGCGACCGGCTATAATGGCCGACGTAGCCA
TGCAATTCTCCTGGCGCACTGCGCCACGATCGCCGTTGATGGGCTCGGTCGAACCCATTGCTCTCGCCGAGTCGGATGGCTGCGGGcgagcaggcagcag
cgagctgtcgACCATGTCGAAGGATCATCCTCGGGCTTTGCAGCGCCATTTTTTCCGCCTTgcgccagcgcctgctgcagtgggTTGCTGTGTCGGGCTG
CAGTTCACGCGTAGACCCTGGAGACTCTGCAACCGAACCCGGGCAGCGAGCGATGCGACAAGACAGGCGGCTCAAGAATTCGTTAGCGTAGCACCGCGTC
TCGACGACACGGAAGAAAGCTGACTATTTTCGAGACGCTTCAGCCAGCGTAGTGTCGGAATCAGAGGCCAAGGGCAAGTCTGATTCCTGGAGTTCACGAG
TTATGAGTCACAACTCatgagtacatgtactgtgcATTGTAGTCAAcggcgttcttcttcgccgtaGTTTACGCATCATGaaactgtacatgtagagaga
GATCACACGAATCCAATGCCAGCGAGTAGCAAGTATGACTTACAGCCATCTTGTTGATTGATGTAACGGtcacaacttcaactataagaccatcactctt
cGAAGCAAATCGTGTTCATCCGACACAGTAAATCGCACGTCGCAGCAGAGTTTTCACGCCATCttggcaccagcacgcagcagcactggagcCAGGTGCT
TCGCAGCGAACGCGCAGCCGTTCCGGATGCCCTTCTCTGCGGCAGGGCTCACTGCAGTCGGGAACATTACCGGGTCGTGCACAATGTTCTTCAGGATATC
CATCTCCATGTTCGTCACTCCTTCAGCGTCTGCCTTCGCCTTAAAACGCAGACCCTGCTCGTAGAACCGTTCCTGGTCACCCCACTGCAGGAAAATGGGC
GGCAGGTCAAGCAGACTGTGGTTGATCGGAGACACCAGACGACGCTCCTCCGGGTCTGTCACGTTGCGCAGGTAcgtcgccaagcagctgTCGGCGAAGT
TGGCCGCCAGAATGCAGTACGGCgtcttgtcgtcgttgtccgTCTCACTAAAGTCCACTACGGGCGAGTAGCACAGCGCCGCCACCGGCTGCAGCTCTGG
ACTCTCCTTGCGCAGACGCATGCAGTTCGTCATGGACATCTCGGCGCCAGCACTGTCGCCGCTGAACACGACGTGGCTCGGAGCGACGTTCTCGTGCTCG
AGCACGTACTTGTACATGTCGAAGCAGTCGTTCAGGGACGTCGGGTACGGGAACTCCGGGGCCATGCGGTAgttggcgagcagcacgtccactGACACGT
CGAGTTGATACTGCTCCTTCAGAAtttgcttcagcttcgtgtgTTCCTGgttggccagctccacgtcctgcagcgAGTCCGAGATGCAGTAGCCTCCGCC
GTGGTAGTGAATGACTACGACgcggtgctgcttcttctccgggTCACGCATCCACATGTGCTCCATGCCGTTGGCGACTAACTTCTCTGGGATCGTATTG
TGCTTACGGCAACAAGAAGTGAGGATGGTCTTGCCGTGCAATTCGAACGGACCTCGCAGGCGGTGGGCGTTCACGTCCGCCACGATGTGTCCGTAGTCGA
GGAACGCATAGCGCATCATGGAAATGGTGAGCTCGTAGGCGAGCGTCCATTCCGGGAACGTCGGCTTGAATCTGCGGGCAACAGCTTCGAATAGCAGGGA
GACGAGCTTGAACTGCAGCTTGACCGCGATGTACGGGACCTTCACGAACGAGGTGGCGAACGGCCACGCAGCGTAGCAAAACCCAGCGAAGAAAAATACA
TACAAGACGACAAGCACGGGCACCAGAATAGAAACCACAATGCTTCCAAGTGCCATCATGAGCACAACGATCAGGACAATCagaagcgcgagcaggaCTG
CAATCTTGAGTGCGCTAAAACAGCTCGCAGTACGGGACTTCTGATGCTCTTCAACGGAGAGGGAGCCATACGCACTGgtcgacgccatcttctctTCCAT
CCACTGGCAAAATCTAGTTTGAGGTCATCATAATAAATGCGCCGCCGCCCTGCCAGTGTAGCAGGCTGCCACTCCCGTGGGAGTCCCCATCGTTGATGAT
AACACTGTCTTTTTCGGGTAGTCGACAGGAGTGAAGCCCGGACGCGTGCCTAGTTTTTGCGTTACTCCCGGCCTGAGGttcaaaaaaaaaaactccGCGA
CTGGCAAGCTCCAGATGCG