Description :
From Genome Similarity Track
Location :
Scaffold_581:14364- 15574
Sequence
1210 bases(100 bases per row)
TATCCGTTAGTTTCACGAGGAGTTAAGCCCTTGCCGCCGAAGGTATCACCGACACATTGACAGGATAGGATGGCCCCCACCACTTCAAATACGACGGCTT
TTGATGTTTCCGCCGTTATCGTCCGTGCGTTTGTTTACACAAACTGTTCCACGAAACACCGCTGACTCTGTTAATTTCACACTGCCGAAGTGGCATTCTC
GTAGTCCGCGACAACTCCGAaatctcctccatctccgatGCACGACTTGACGTATTGAAGTAGTAGGGCATTGTCtacgctggtggcgctggcagaaCTG
GGCTGGTTCAGCGGGTTGCGGCTTAACTTTAGAGTAAATTTCGGCGATGGTGAGAGTCATTCGAGCACTGGAGTAAACGTTTACAAAAGAGGATGTGGTT
CGAATAAATGGCTGGACAGAGTCAATCAGAGTAACAGCCTGGCCATTCAGCAAGTCGCGTTCAACATGTACGggtcggggggggggggcaatCAGCAAAC
CATTGGGCCAGAGCTGACGGTCCTGACCAATCAGAGGCGACGGTTAGCATTGTATCACACTCTGATTGATCACGACCGGACGAGAATCCTCCCTCCATGG
GAGCCATTCGCCTCCGAAGGCAAGCGCGCTGGTGTACACGGCGCGACTCAGTGGGGCAGGAATGCATCCGCTAGGACGCTCACGCCTAACGATCGTGGTT
CAAGCGAGTTAACCTCACCAGTATAGGTAGGGTTCTGTTGACAACTGCGCAGCTCATGGGTGATGATCAAGGGCCAAGCTGGCAGTCTGCGTGCTAACGT
AAAGCGGGGTGTGGTGGAAGCCGACCGCCTCACGCCAAGACGTATGGGCCTGTGCGAAGTCCGCATAACAGCTCACAGGTGACACCGTGGATCAAGCCGA
TTCGTCTGTATTTCTGCGTGCGACGGTGTATTGCGTCGGTGTGGAAACTGTCCGCCGGAAGGTGGGACTCGGGGGCACGACGGCTTTACATACAAAGTCA
TCGCACCGTATCCCATCAGAAACCAGTCCATAGGTGACGACCGTGGTCCCGACTGGTCGTCGGTGCCTTAACTGCCTGCGCGCAACTCTGGCTGGTCGCC
AGGTTGCTGGGCGTGCTGTGGTCACTTTCGCCCAGCCCATTCACAGCCGCGTATTGACACACAAGGGCAAGCTGTAAGTCACATGGTCTGCGCCACATGA
AGCCAGCCGT