Description :
From Genome Similarity Track
Location :
Scaffold_10:143637- 169894
Transcript NameFunction/comments
Phymu_g814conserved hypothetical protein
Phymu_g815hypothetical protein
Phymu_g816hypothetical protein
Phymu_g817aspartate aminotransferase, putative
Phymu_g818protein kinase, putative
Phymu_g819hypothetical protein PHYSODRAFT_472892
Phymu_g820hypothetical protein
Phymu_g821hypothetical protein

Sequence
26257 bases(100 bases per row)
CCTACCATCTCTTGGCTCACTAGGAAAAATTCCAGCGATTGTCCTGTTTGCGTTACTTTCCGAGCACCCACAACGTGCGCGTCTTCACTTTGGGCATTGG
ACAGTGGAAGTTAGCTTGGCACACGATCTACCAATACTAAGAAGTACTTCATAGTATAAAGCAAGGATACTTACCGCAGTCGGGGGAGAAGTAGCGCCAT
AATTTGTTCATTTTGTTCCACCAACCTCGCTATTGAATTGTCGTTTGAGCCCGGTAATCGGTCAAGCAACGAAGACTTGGTCCAGGGATTGTTGCTGAAA
ACTGGCTAATACTTTCTGCTCCAACATTGTAAGCTATAACCTGTTAGACATTCTCCTCTATACTCCGCGCTACGACCATGCCTTACCAACCCACCTCGTA
ATGGCGtacttgctgctcaagcaTATGCACTTGAGCGCTGCAACACAAAACTAAATTAAAGATTGACTTCaaaagaagcagcgcaacatGTAGGGATACT
TCAGTTCGTCCCTGCACTCTCTTCGAGCATCATTCAACGCATTCGCAACAACTCATTCATCAaggcttcttggcgacgtGTGAGTACATGTTCTTTCTCT
GCATTCTGTCGTAGTAGTGAGCACGAAACACCCCATGGCCACGGCTCTGAGTTTTGCATTTCGACGGCGGCAGCACAATATTGCAGTGTTGCCGTCTTGT
TTTGGCTGGATCTGGACTACAAACCATTGCACTGATCAGTATAGCAAACCTCGACTGACTGGCACCGTGAGAAGTCTTGTATTCCGCCGCTTTAATAAAG
ACTTGCATATCAGCTCTCTGCCGTCACTTGatcctgctcttcaaccACATTATCGACGGTCTCCTCTTCACCAGTTTTATCAGTAACAGGGGCGGCTTGC
TGGActtttttctcttcttgtctCTTTTTgtcgtctgcttcttgctccGCAATCTCCTTCTtagccgcttcttctcgcccaaGAAAATCGTTCGTTAAAG
ACTGCTGTAGGTCCTCAATATCTTGAATAAGCTCGAGTGACTTCTCAAGAATTTGCGTAGCTGACTCAAGCGTATTCTTGGATGCTTCCATAGTCATGTT
GGTAAACAGCGTACTTGCTTTAAATGTTCCCTTTGTCATCGTGGCCTGAACGGCACGAATCTATAGAACAAGAGCAATCAAATGTATCAGCGTAGAATCT
CTCGGAGTGTTTCAAGCTTGCATCGTACCTGGTCTGACAAATCTCGCACTCGCTTCGAAATATCCCCATAGCGGCACTTCATTTTGCCGCAGACCACCGG
CAAGGATGCCTCCGCATCACTAATATCCACCACACCAGGTGTGTGGATACCTTCGCCTGCAAGACGGTCTCCCTCGGGTACGTAAGTAAGCAGGGATGCC
TTGAACGTGCACATTCCCGTTTTCTTCAGTCCGTACAACTTCGTCTCCGACTCCGGGTTACTGGAGGGAATTAGTTCCACAACCATGGAGTAATGATCAT
TATCCATGCAatcgtcgccgtcgtcgtaAACCATGTACTTGTAATTCAGCGTGATAGGATCGATCTGCCACCCACGGAAGATGCTGCAATAAAGTGTTAA
GCAACACAGAACTACATCAGAAAGTGTCACGACAGCGAAGAACTAAAGCTCAACGAATTACCCGAGAATAGTAGGGATCTCCGGCTCGTCTTTTTCTTCA
GCCACGGGGTCTTCAAGCTTCGCATTATCTTCGTCGCCATCCTCTatgctggcagcttcagacACACCGTccgtcacttccagctccacttcaaccttCT
CTTCCATCTTGGCTTCAATTGTCACATTATTTAAAAGACACAAGTCCAGGATATAGCTAGCAACAAGGTTAGATGAGCAGTCCAAACGAAACAAATGCTG
AGAAAAACTGGTAACACCTACGATTTACCCTCCTGCATCTCCCGTTCCTCACGGATACAAGCTAGTGATTCGAGGCTGTCGACAAATGGGCCTGGAATAC
ATAATAACATACATACAATTATTGCATATACACCAATATTTATCTTTCGTGTGATCGATGCTTACCTTGGAATGCCGGAATTGGATCACGGGACGGAATG
GGAACCAATAGTGACGAcacctcctcttccagtCGCGGACGGGGGATAATCTTAATGTCGACCTTGGGTGCAGCTTCACACAAAGTGCTACTCAGGGCTA
CGGCGGCGACCGCGCCGGCGACCAAGCACCTGCCCTGCATCTTATGCTTGCGTGGCAATTCCACTAATGTGTTTTCACAGGGTTTCCTACAATAATTTTA
TTTTAGTTTAATCTTTACACCGATATATCCAAAATAGCAggtagttgaagttgaagcagagTGATTGTAACACGAGCCCTCAGTGCGGAATCCACCGCGT
AGAGAGCAAGCAACCCGAAGatgcaggaagaaggcgcaTCGACGATCTTGAAATGCGTGGAGAGAGCGACGGAGCTTCTCGgacgtgcagcagaagcctC
AACGGAGGATGTGTCAGCCTTACACGAATTGCTGGAGGAACTTCAAAGCGCTGTTGGTGCGTTTCGTTCACAGAGGGTCCTGGAGTTATCTGGTGTGCAG
CTGGTAAATGCTGGAGTGGAGCTGTACAACGCTCCTAGAGCTGCTCTGAGCGTTTTGGCACAAGTGGAGACGGCTAGACATCAAGGGGACGAGCAACGTA
CAAATTTCCCACGGTATTTGCTAGCTGTCACCCGTCTCACAGCGGCGAAGATCATGGGGTTATCGCTGGCTTGTTCCAAAGACAGCAATAAACAGGAAAA
AGGAGAGAACAGAAGCATGCAGTTCATGGATGAATGTGTCGACGTTCTGCGTTCTTTTGGCCGAGTGGGCATGTTTATGTTGGAGAGCGCGTCAGTGGAC
TGTGAGAAGTGCGACGAATACTTGGCAATGGCAAAAGAAGCTTTCTCATCTTCAATGCAGCTCTGGTCTCGTATTGGGCTCTCTCATCTAACTAAGTTTA
AGCACGgattggagctggagcacgtcGTGGATGATTTGTGGGATTTTTGTGCAGACCGAGTGCGAGTACTTCAGCTCGTGGCAAATCATTCCGGTAATTC
ACCTGAAGAATTTCGAGATATTTTGTCATCGCTGCATGAATTGAAAATGTTGGCTCCGTACAAGGCTGCGTATGCAAGCAGTTTGCTGGACCTTATGAAG
AGTTTGAGCGATGGATACAGTCAAATGGATCATGAGTTATTAGTGGAGCTcacagaagaagctctgcgTATCGGTGACTCACTAGAAAGTGATACAGATG
AAACTTTCCCAGAGAAGGTGAACTCGTTTAAACAGCATGTGCTAGTGAACTTGCTGCGCTCTCTGTGTGTAACTGGGGATCTTGACCGAGCAGAAACGTG
CTACCAACTTATCCCAGCTAATCAAGACCCaaagttgctgctgctcatgaaCAAGCTTTACATCGATACCAGGCAGTTCGAAAAAGCGCATCGCTTGCTT
CAGCTGCTATTCGAACAGGATAACTTCGAGGACTCCCTTTTGGGCGCTCGTGCGTTTGCCCAAGGGTTTGGCTTCTCTGACTCTGGTTTGGATATTTACC
GAGAGCTTGCAGACAATTACGGGGATGCCGAGTTCGCCATTAATTTGGATGTCGCGTGCAGCCTCGCCTTTGTTGACGGCAAACAATATGAAGCGATGAA
TGAACTTAAGCGTATAGGATGCGCTTTGTTGGAAATGGGGCGGTAGGCATCGATGAATTCTATAACGGAGAGGTGGCCTGCGCACTTACACTTTATTTTA
CAGGGGTGAGCAACCTGCTGATGGCAACACACACATCCTTCGAGTACGACAGACAATTTTCGATGGTCTTCAAAATGCTGTGAACGCAAACCTACATGAG
GTAAATTGCCGAAGTGCGACATCGGTTGTAGTAACATACACTGACACAGCTGGTGCAGGACTGTTTGAAGTGGGGGGATGCGGGCTTGGTAGTGGCATCA
ACACCACAAGATAAGGCGATGTACATGAGGTAGTAATGTCTTCGTTATTTCAGTTGCCTACATTTCAGTTTGATCTAATTCACATACTGTAGGATCATGT
CTCGCTCGTGTCTCCAGCTAGGTCGTAAAACCGAAGCGCTAGACTGGGCTAAAAAGGCTTTTGCTATGGAGGCTTCTAGGCAGTCTGTGTTTAATCTGTT
TCAAGTGACACTTGAAGCAGACTTGGACGCCTCAGACAATGAGCTAGTCCACATCATTGAGGAGCTAAAAGCCAGAGACGATTTTGAGGTTGAGGACTTG
CTGGCTATGGGTAAAGTGGCCACCAACCTAGGCCAATCGAGGCAAAATATCGTGCTACACATTCTGGATGAGCTCGCACAAACTGATGGTTGCTCGGCAG
CGTTTCCTGTGGCCGTAGTCCTGCAAAATGCCGCTCAACTTCTATTTGACAAAATATCCCAGCAGCACGCTGAGCCCAGCGACAAATCAGAAACTTTTTA
CGGCGAAAAATTCTTGGCGTATGCCAACAcattgttgctgcagtcagCAAGTCAAGATACAGCCCACTGCGAGGAGAGGTTTGGACCTTCTTCAGTCTTC
GAATGGTTCTTTCGAATGAGGTATGCAGAAGGTGTACAAATTGTCTACGTGTCGGCAGCAAAATTAACGAAAACGTTTTCACCACAGCTTTGACATTGCC
AAAAGCACTGAAGACTCTAAATACTTTATCGTGGCCGCCGCTATTGCAGAACAGAGCGACGTATTATATGGAGAAGAGTCTCCCCTCAAGCAGAGATGCC
AGCAATGCTTGCTGGCTGCAGTTAGTGCGGACATGAAGAAAATTGATTTACTGGATAAAAACCAGTTGTTGGAGGTGCTCGAAGTGATCAACCGGATCGG
ACACATTGAAAGCGGAGATAcgtctgttgctgctgaagtcaTGAGCTACTTGGTATAGATATCGCTTGCTCTTTACAATAGTGGACACTAACTGTTTCTG
GTGTTTCAGGCGCGGGCAGTGATTGCGGTGAAGTTGAGGCTGTTTGACTCAGACACAAAGGCGATTTTAGATTTGTGCAAGGCAACACAGTATAATGCTT
CTGAGCTCAGCGAGATTGGCGGTGCGTGACTGCCACTAGTTCTATACGTAACGATGCCACTGACGTGTGAATTACTCTGTAGAGCTAGTGGTGTATGCAG
CAAAGTTCACTGAAGCGTCTGAGGTGCGATTTTTGTTTCGGTTTTTCGTACGCCCACCATGCTAAAATGGAGTATTTGATCAGGTTCGAGACAGCTATCA
GTCCTTAGCTGGAGACATTTTCAGTTATGGGTACGCCACGTAAATCTTCGGTCTGGGCATTCACTTACAGCGAAATGTTGCAGGCTTCAAAAGCTGGCAC
AAGAAAACTCAACGGACGCTAGCCAGCTGAGCTATCTGCTGCGACGGCTTATTACGCTGGCAGATACGAAGACAAAAGCACACGAGTGGTTTGAACAACT
AATTCAGTTGATGGACAGCTTGGATATTGTTTTTTCTGAGATCGACCTGGAATGGTTTGTCGCGAAGGCGTGGAACACCGTAAGTACATTTAGATGAACC
GTTCAAACCTGTCGTTTGCTCTCTactaagtacatgtacacgtcTAGGGTATCCTCTGCTGCCGTGCTAATGGCACCGAAGATGCATTGCAGTTCATGAA
AATTGCTCAGACTATCATGCGTAAGTGTGGATTCATATTGCCCTCGACATTCCATAATGCtcatatacatgtatgtgcCGCTGGGCTGTGTAGAGCACAG
CATACCACTCGTGGAAAAAATGGGCAATATGCTCGATCAGCAGTACCAGGATCTACTAAGATTGAGCGTGAGCTCGACACAAGCGAATCTCGAGTCCAAT
GTCTGATTACTTGTAGCTTAGGCAAACTGGTTAAGCTCTCACCCCAATGGTACATCAGTCATGCCTCGTACACATCAGGGTGTGAGTCGTGACTCGATAT
CCCACCCATGTGCGTTTTCACGGCCTCCATATAGGTTTGTAGAGTCGGCAGTTCTGTCgtttcttccttcttcagAACCTTCGAGGCCCACTTGCGTTCT
GCATATTCACAAATCTGTTCGAATAATTAATACTCCAGTAGACGACCATTTTCACTAGCAACCAGTTTTGTCAACGTACCTCTTTGATATCTCGGCACGA
GAGCTGAGGCGACACGACTGCCAACTGCGAGAGTTCCTCTGCGGAGAGCTGCTTAGCATAACTAAAAGAACGCTCAACGTCAGGACTCTAGCCACACATA
cgcatcttcttcgtgaaAACGTAGTACATACCGGGCAAACACTGCGCGGCGGGTGTTCTCGTCTGGTAGATTGTAACGAATGGAAAGATCAAAACGGCTG
ATCAATGCGGCATCCAGATCTTGCTTCCTGGAAGGTCAACAATACACATCATCAGGTTAGTCTATGCAGCATATCAAAAGATATAcaaaaagcaaaacaa
aCTTGTACGTACCGGTTCGTTGCACACACAACTGTGGTTTTTTTGGCAGAGGCAAACCCCTCCACCTTTTGCAGAAGAACTGACAAAATTCTTCGCGAAG
CTTCGTGCATTGTGCCGCCAGAACGGTCTCCAGCAAGTGCATCAATCTACCACAAACAGAGCAACGTTCGTAAGTACCTCATAGTTCAGTAGTACTTCGA
AATTTAAAACACTGGTGATAACGTACCTCGTCAATGAAAATAATGGCACCATCAAGCTTCTCACACGCGTCAAAGATTGCCGACATTTTCTTTTCACTGT
CTCCGTACCACTTGGACACTACACTCTCGATTGGGATATGAATCATGGGGATTCCAGCCTGTTGGGCAATGATTCGAGCACTTAACGTCTTGCCGGTACC
TGGAGGTCCCTCAAACAGCACAGCACGGGGGCGATTGCTTTCATAACGGCAACGCGTTTTCTGAGCAATCCGCTCGTACAACTCTGGGTTTTGAAGTGCC
AGCACAACAGTGTCTTCTATCTCCAGTTTCACCTTCTCGTATCCAGCCTATACAACAGCCACAATTAGTGGAAAAAAACTCCCTAACAAGGCAATACATA
ACCATGACGCACCAAACTGTCCCAGGTTAAACTGTTTTCGTTCTGCGTTGGCTCAAATACATCAATCCCAAGAccttgcagctgctggatTGCCTCTTCC
TGCATCCACGGTTAAAGAGGTGAGGTATCAACGCAAGCCTCCACTGAGGAAATACAACGGACCTTGGAGTCGGGTGGTGCAGATGTAGCGGTAGTCAGAT
TTCTACCCCGTCCAACAAGTGCATTTTTACGCCGTTGCTCGAGATCATGACGGAAGAATGCGTTCACATTTGCATACGAGTAAATCTCCTTGTAGGcgcc
aacaacagcatcaaTCTCGCCTTGCGTGAGATACTCATCCTTGTAGAAAACGAACTTCGACGTTGCCTGCAACGATGTTGTATCGCGTAGAAACTGGAAC
GAGCCGGACCCGTTCGTGTACAGGTACGTCACTGCAGGTTGTTCGTAGGACTCCACTACAGATTTCTTCGTCGAGCTTTCCAGCGGAGCCGGCATCACCT
CGACTGCTTGGCGGGAACCAGGTGTTGCCgctttctgcagcttcagcaagaaTCGGCCTAAGATTGCCTCCTGATCAACAAACGACGGGCAAGCAAACTC
AATCCGAATCGTTGATACGCCATTCGGCGCATGGATCCTGGAGATGCCAATCTTCTTGATGGGGAAAGCCTTGGGGATGCGGGTCTCAGAGCTCTTGAGC
GTCGTGCGGAACTCCGACACTTGTTGGCGAATGATATCCACGGCCTCAGCGTACTCAAAATGCTACAAAGACAACAACAACTTAGCCACTGCTACCAGTT
TCTTACTCACGGAGAAACCCCTCAAAACCTTTTCATATTTCTTGTCTGGGGTTGTTTCCAATTTTGTAGTATCCACAGCAGCCCCCGTAGCCCCAACGAG
CGCGGCAAGTCCAGCCAGAGTTGCGAGGCCATAAGACGATGAGTCTCTGGAATCCGCTAAAGCTTTAAAGGGAAGTGTAGCCTGGCAGCTCTGGGTTAGC
GTTGTAGAACGACACAGCAAgacttccacttccactggAAGACGGCTagcctgcttcttggtggctGTTACGGCGCGCGAGAGAAGCTTCGGCACGAGTC
CACGCTGCATCATGTTTGGATAAATTCCGGCAATCGAGTTTTTTTGTTTTCCAGGTGGTTCAATCGTACTTATGCGAATCGATGCAATTTCACTGCAAGC
TAAAAGCTCTGTATTTCATTTGTATTATTCTCGGGCAAACACATTGGCAATGCCATCAATTGCATCGCAGTTGATAAAGTGTAGCCCAATTCTTATGTAC
CGCGAACGAGGACTTTCTTGGGAGGTGAGTCGCCTCccttttcctcctcttcgccttcgcaATGCTGACGGTATGCAGCAAGTTGCCGTCGGAGAGTGCT
GATAGTCTGGGCTTTCTGGGCAAGAATCTGCCAATCGCACAACAGATTAGTAAGACGTACTGCGGTCGAAACGTCCTTATAAAACACCCACCTCTTCCAG
ACGCGACACGTACTGCTCGATGCTCGCCGAGTCGTCGTTTTGAATTGCTGCTAACATGGCGCCTTCCTCTGTCAGTAGCTCTGCATTTTCCTATCACATC
ATAATAATGCCTACACTTAGTTATGAACCATAACCTGCATCCGTATGAAGCAAAGGTAAACCTGAATTGCGCTCATGTGTGTGTTGAGCAAActttcttg
ctcttcgtACAATGTTTGAACCTGTCCGGGACAGTCATCCATTGTCCTTGTTAGTACACTGTCTTCGGCTCGCTCGTAAAGTAATGCTAAGGTATAACGT
ACCACTCCTTGCCACGCTTCTTCAGGGTATTCGTTTTCCTGAACGGGGTCACCACCACTTTTATCTAATgtcaccagcatcgacaaAGCACATTAATTCG
ACTCGACATTCCCCATACATCATTCATCTTCAACGCACTGGAATTGCGCCGACGACTGAGACGAAGAATGCTCAAATCGTCTCTCAAATCTTGACCACCG
TGAGCATGGTGCGATGAAGTCGTAGCAACGTCGTTACTACCGTCGCCAACATCGCTCCTATACTTATCGCCTTTGCCTTCGCGCACCAtttcatcttcgt
cctcaaGCGGATagtcctcttcgtcatcaaaTTCTCCATCGACATCGTCACCTTCATTTTGGCCAGTGTACGCGTCATCACCGTCGAGGTCTAAGATACA
CAATAGATGTCACAAAATAAGTTACTCATGGTGGTGCCACCATCGAAGCCCATAGCTTCAGGCGCACCTTCAAATTGGACATCTTCGACATCCACGGGAT
CAGACTCTGCATTCCCCTCGTCAAATGCATCCGCTGAAACACGTTTCTCCTTGACCCGATCGGCATAACGAAGCGTATTTAGTGTGTGATCAGAGGACGA
GGCACACGGCGAAACTGCTGCAATCATGACAGTTCTACAAAACTCACATCATTAGGTTCGGTTGGTGATTATAATCAAAGAGATCACTTCCTACCTCGCC
TTAGCGTTGACAAACGAATCTTTCAGCACTTGAGTGAGTTTGCTCGCTCGGAAAGGAATGTGGGCTCCTCGGCCACCACTGTCCAGTGCTCTGAGCATTA
AAAAGACGGGTGGTTATCAGCAATTTAGCAGATCAGGATCCAATTAATGCACTTGTACACATACCTGAAACATTCCTTCAGGGCCAGCAAACTTCGGTTG
ATTTCGGCCGATTCCATCCGTCGCTGCCGATTGTGATTTTTTGTGTCTTCGCCGCGTTCACTCCCAGCAAGATCGATCAAAGATAACTTGCCATGAAGTC
GTCCTGATCCTTTCTCGCGAAGGTTAATTTGACAGATGCAGTGCGAGCGGGACGACACATCGTTCACTTCAGTAGCATGCGTCGTGCGGAGACTATTGCC
TTTGCTGATCACTTGCAGTAGTTCCTCTGTATTCTGGGGCTGCACCTCTTCTAGATCCACAATCTGCActtcaccagcaccatcTTCCCGAATAGTCAGT
ACCTGTCGATGCAGTAGGTCTTGGCAACGTCCACCGTAAATCTCAAAGAAGCTCACACAGATATCCAAAGGATAACCACGTCTGGCAAACTCGTCGGCCT
GGGCGAACACATCCGCCGCAATCTGGCTCTGGATCCCTTGCATCGTGTGCGTCTTGCCGCTGCCCGTTTGTCCGTAGGCAAACACCGTAGCGTGGCCTCC
ATCGTGGAACACAAACTTCACCAGCGGCTGAgcagtgtacatgtacacgctCTGGTTGGTTGCGTTCTCGTCAAAGGTATGATCAAAATTGAAGGCGTTG
CTGTCCAGATACTTGGTAATGCCGTCCACCTTCAGCTTACAGTCGTGCACAATAGCCATGGGATTAAGGCACGTGATGGCGTCGTAGTCGTGTTTCTTCA
CCTCCTTGGCGTTCACCGGACGTTTGCGCACGCAGATGGTGATCTTAGTGTCCACCGCCTCAGCATGCGGTCGGCTTTTGTCCTTGTTTTGCTCTCGGAA
GGCTTTAATCATGCGCTGGAAGTCGACGTCTCCCGGATGTCCGAGTTTTTCGTTCATTTGGCTCTCGCGTTCACGTTCGCGTTTGGCCGCCGCCATGGCT
CGTCGCCGGTCCTCTCGattcttctcgatctccgcgATGGCCTGCATAGTGGGCTTGGCGCGTGGCGGCGCAGATGGCGCCCCACGTCCGGCGTTAGCAG
GCCGCGCATTATTCGCTCGCCAAGCCATCGGAACGTCGCTTGGAAGTTCCAGCTTGCAAAAAAGATGTTATCAGATGCTATTTttctgataatatctgag
tCAGAGTTTCCAAAATGCCTGTCAGTAAAATAAAATGGCTCGACAGGTGAACGAGGAGGCGGCCATTGAGGCCGTGCAGAGCGGCGCCATGTCGCTACGC
GAGGCTGCGCGCAAGTTCGATGTGCCGCGCACCACATTGCAGCGTCGGGTGCAACGGCGCGCGTCGGAAGCCTCGGGATCAGCTTCGTCCGATACTGTAG
TGGACGAGGTTGTTGCTCCGGCTACTGACATTATTTCACACAGCGATACGAGCAGTGATGACACAGTCGAGTCTACTACGGTGGGAAGTCGAGATCCAGT
TGCTGTCACAGGCCACAAGAGATCAGCGAGTCATCTAGAGACAATTAGTCAAGGTAATTTGTATCTTGCATTGTGACGAGGTGGTAAAAACTTTTAACGA
TGCTGGATTGAGTGACAATTAGGTCCACGGAAGGTTATTAACTGTAAAATTAGGATGCTGTGCacggcagcaggaagcgcgctggacgagctgagTAACA
AGATGATCAGGGAAGGCAAATGCATTTACAAACTAGGATTAGGCCAGTCGCCGTTTCCAGTCCCGCAATGTATTGTTGATGAGCTGCGGTGAGTATCTTA
GAAGAGGAGAATTGTTGCTACCAATTGAGGCTGACGAATCCTTTTGAGCGCAGAGCCAATTCGCACCAGAGAGACTATTTACCGGTTGCAGGACTGCCGG
AGCTTTGTGATGATATCGCAGCGTGGGGGACGGATCGGTTGCATATTGACTACTCGAGGGACGATGTTTTGGTGGGACCGGGCACCAAGGAGCTGCTatt
tgtgctgcagacggTTTATTATGGAGACTTGTTGTTGCCCAACCCAAGCTGTACGAGTTACGCACCTCAGGCCGCTATTGCTGGAAGAAACATGATGTGG
TTGCCAACCCATGCAGAGGACCACTTTGTGCTTCGTCCagaagtgctggagactCATTGCGCTAAAGACCCAGGTGGACTTTGATACTGCTTCGAAGTAC
GAGAAGTTTGCTCACATTGAGTCTTGTTTTCATCAGATGCCCCTCGGATTCTCATTTTAAACAGTCCGTCCAACCCAACTGGCTGCGCTTACCAGGCAGA
TGAGGTTTGAGCAGTTTTCCATGCCCCTAAAGTATTGAAGATGACGAACTAACGCTGTTGCGATGGCTTATCAGCTGGAGGCACTTGCAAAAGTCGCGAG
GAAATACCGGATCCTCGTCGTCTCGGACGAAATCTACTCGGAGCTACACCATTCCGGCACGCACTTGTCACTTTCGAAATACTATCCAGAAGGGACTATC
GTTTCCGGAGGAATGAGTAAGTGGtgcggcgctggtggctggCGCATGGGCTTTTGGCTATTCCCACCCAGCATGGGCTGGCTTCGCAGCAGCATGCTCG
TCATGGCGTCCGAGACCTACACGTCCGTTGCATCGCCTATCCAGCATGCCGCTCGACGAGCATTTGTTCTCGAGTACGTAGCCCGTTCTTCATCCTCGCA
AGCAGGCAACCAACCTCGATACATCGCTCCAACGTCTCACCTTCCTGTAATTTTTGCTCTCTGCTCTCTGTAGTTGCGTCGAGCTGGCGTCGTACAAGCG
CAAGTGCCAgaaaacgctgcagcttATCGGTGGTTGGTTCGCCTatcagctgcagaagatggaTGTGGAGATCCAGGTCCCGGAGGCCGGCTTCTATCTG
TTCCCGTGCTTCCGTCGACACCGCAAGGCCCTCGCATTGAGAGGCGTTTCGACTGATGAGCAACTGTGCGCACATCTGTTGCAGGATACGGGCGTGGCAA
TCTTACCGGGCTCGGCTTTCGGTCGTGCGCCAGAAGAGCTCTTCGCTCGGCTTGCGTTTGTCGACTTCAAGGGCGACCTCGCGCTCTACCTCATCGAGAG
CTTGGTACGTCAAGCAAGGCCTTTTCCTCCAGCGAGCAAGTGCGGTTGTGCCACCGAAACGCTGATTCCCCTCTGTCTGTGCCTTTGTTTTTCGCAGCAA
GACGACCCGTCTCTGGAGGCAATCGAAGGCTTCATCCAGTCGGTCTGCCCGAATCTTGACATCGCTATGCGCAAGTTGACGGCGTGGATGGCTCTTGCTC
GGCCGTCTGCCGCGCCAGCAACGGCCAGGAACCCCGGCGTCGGCTTCTAAGCCCGGTCGTTTGAGAAACCTTCGCTGTGTTACGCTGCGTAAGTCGCGCA
ATGAAACGCTTTGGCCAAAGTTCGGCTTTGGCAGGAGGATCAGACCACTGACGTCACTGGCCACGAAACTGCAGCCGAGGCCGTCGTGACGCGCCGCCGT
TTCTTGTCaaacatgaagaagatcttaTTCTCGAGATATGCAGTCCGCCCACCGCGTTAGCCACAGCTGCCAAGACCACGACGTTCTCAACTCAGTGAGT
TGGTGCCAGTGACGCCACGTTGAGCTTCCGGTTTGGGGCCAGGGCTGACAACTTCTACATGGCACCGTTCGGCCGATTTGTGGCGAGTAAGTAGCGCGCA
GTCACTGGTGCAAGACACTCATTTCGTCCAAGTTAGAAGAAGGATGGCACTAAAAGTCAGTGCACTGCACTGTGCGCATatccagtacatgtacacgtag
tcgcTTGCTCTTGCTAAATCAGAACAACTCTCCTTCTTCTAGTTTTGACCATTTCCGTAGGTGGCACGTCGTCATCTCCGCTCTTTTTTGTGACCGATTG
TCCATTCCTGTAGCATTACCCTCCAATCGTCAACAAACCAACGTTTTAGAGACAGCCTTGCAGACTTCCACTCTACAAAACCCACCGGACGACCGCACAA
GCCGGCACGAGCTCCAAGACGTCCCCAGCGATGCCTGCGGTCGACGAGTACCCGCGCCGCCCGCCCATGGACCCGCCGGCGCGCTCCCGTTCCGCGGCGG
GAAGTGCCAGCGGCCGCAATATCAGCGCGAcgttccagcaccaggttCAGCTCCGGCCGGGCGCCAACTCCGCTACTAACCTGCGCGCGTCGTACCAGGA
CCCGCAGACGCACCAGAAGCgccacaacaacagcaagaagagcgcgcAGATGCGCCACTCGATCACGCACCTGCAGGACGCGCCAGCCTCGGGACgctcc
agcgcgtcctcgtATACTTCCGGGTCGGTTCTGTCGCCGCCTGATCGCAGCTCGAACTACCTCAATATCCACACGACAAGCAGAGATCTGAGTCCGCAGC
ATCAGCTGCATCCGGAGTATCCGGCCGCGCCCCCAGCGGGCGACGATATcctgaaggtggagatcccCCGCTGGAAATCCAAACTCACGACGGACAGAGC
AGACAGACTGCACATCCCTGCGGGGGCGGATAGCGCCGGGAACTCTCCTGTGAACAGCGGAGCTGGACGATCTTCTACGTGGAACGGGAAAGATGGCCGA
GGAGGCCATGGAGGTTCCATGGGGGCATTGGTTCTTGGTCGAGATCGAGACAATGGAAGTAAGAAGAGGTATACGGTGTTCCAAGTGTACGTGCATTTCC
AGTCAGGCGCTATTCGAGTGTCGGAGAAGAGATATAGCCACTTCCGAGAGCTGCACAAGACGCTGAGGAGGAAATACGCTACCGTGGGGAAGCTCTACTT
TCCCCCCAAGAAATTCTTCATGTCACTGTCTCTACGTGTCATTGAGCAGCGTCGAGAGGCCATTGAGACGTACATGAACGCAGTGCTGACGCTACGACCA
CGACCCGTTGAGGTCGTGCAGTTCCTGAAcactggaagcagctccattgagagcgaagaggaggatgGCAACAGCACGGATGGGGCAGCACGCGGCGTGG
ACATGGTGACGGCACCCAAGCACGTGCAATCGACGTCAGCACTTGCTACTTCTTCGCGGCTCAGTGGAAGCAACAGCTTTGCCTCGGAGGACGCAGCAGG
GCACATGGTGACCATGCAGGACTTTGAGATTCTGAAAATGCTTGGAAAAGGATCGTTTGGGAAGGTCTACATGGCTAGAGAGCGCGGCACAGACGGCAAG
ATTTACGCGATGAAAGTGCTGCGAAAATCGGAGCTGGTTAAGCGCAATCAGGTGGGACACACCATGATGGAGCGCAAGATCATGAGCTCCATTGACCACC
CGTTCATTGTCGGTCTCAAGTACTCGTTCCAGACGGCCAGCAAGCTCGTGATGGTCTCGGATTACTGCTGTGGCGGTGAaatcttcttccacttgaagaa
gttccgCTCCTTCTCGGAGGCTATGGTGCGCTTTTACGCCGCTGAACTGGTGGCGGCCATTGGCCACTTACACGAACGGGATATCATCTACAGAGACCTC
AAGCCGGAGAACATTCTTCTAGACGAGACAGGTCACGTGCGACTGACCGACTTCGGTCTCTCCAAAACGGACTGCACGGACTTTTCTGGCGCCAAGACTT
TTTGCGGTACACCGGAGTACTTGGCACCGGAAATGCTCATCAGCCgtaagaagaagacggagtaCGGTAAGGCCATTGACTGGTGGAGTCTCGGTACGCT
CATGTACGAGATGCTCACTGGTTGGCCACCTTTCTTCGACCGTAACATCGAGCAGATGTGTACCAAGATCATGAAGTCGCCACTGAAGTTCCCTGCACAT
TTTGGCCTGAGCTCTGAAGTCAAGAGTCTTATTTCAGCTTTGCTGGAACGCGACCCAACGTACCGGATCGGCTCGCGGCCTGGTGCCGGTGTAGAGGATA
TCAAGAACCATGTGTTCTTCGCCACCATCGACTggaagttgctggagaagcgagGCGTTAAACCGCCTTTCAAGCCGCGTGTGCGCAGCCCGACGGACAT
CCAGAACTTCGACCGTGAGTTTACGAAGGAGTTGCCTGACCATGGTTTCTTGCAGCAGGACAAACGTCTGGCCGTGTCGCCCAAGAACGAGTTCCAGGGC
TTCTCGTACACAAGGATTGAGGAACCGGCGTTGTTGTCGCGCGAGTCAAGCAGCAAACGGGAGAAGCGCAGATCAGGACGGAGATCGGAGCCACGAGTAA
GCGAAGGGTACGTACGAGGAAGACATTGAAGCAGCGATGGACGTGAACCTGGTCTGCTGGGTCATTGTCGGGATCCCTCTGATTCTCTCTTGCGTCTTGG
GTTGCGCCTTGGGTGTTACTAGAATCGAGCGCGAGTCCCAGTCAGATGATCAATATCCTGAATTTGGCCTCGTTGGCCGCGACAGCACGGATTTCGACAC
TGGCTGCATCTAAAACGCAAGGAAAGCCGGGGCAGCTAGCTGCCCGTGGCCACGTGCGCTCGTCATGTCCAGTACAAGGAGAAAGCAGGTGGGCCGCGCC
ATTGAGTGCAGATGCGATGTTATTTTGTTTCTAATTTAGAGTTGATACAGGTATGAAGCTGATCCGAGCCAAGTTTTCGCTGGGAGACGCGAAGTACGTT
GTAAGAAAATGAATGAATCTAAAGATTACATACTCTCAGTGATGTAAACCGTCAGTTGGTTTCTGCCACTGGTGTTTGCCATAAAATACCGGCAGCATCT
TGCGCATGGGGTGCAAGGTTTTGTGGTCCTTGAAATTGTACACACGCTGCCACTTACCGTCGACGTTGGCATAGCGGTGTGAGGTTTCGCAGGATTGCGC
TGcttttaaaaaaaactatcGTTAGCTCAGTATCAAACCCCGAAAGACTACGGACACTTACCGTTGCACGCAGCGCACAAATCATAATCGCTGCACACGG
CACAGTTAAACCGTGCTCCGGAAAAGTCAGTTTCTCCACACGAGTCACAAATGAAACCAAGGTGACGGCCTTCCATTATGTAGCGCAACGTAGCAAGTGC
GTCTTCATGGCACTTGCGGAATGCACTGCGCACTCGGAACTTGGGGATATCCAGCTTCTCTGCCAAACTCTCAACTTGTTCTAGTGTGGGTTGTGTTAGC
GCACGAGAACTGAAGAGATCACACGCTTCACTATAGCGCTCCAGAAGCAGATCGTGCAACCGGTTTAAACCATTCACTGGCGAAAGATCGCCAGAATTTT
GCGGCCGAACGCAGAATATCACAATATCTGCTGACTGCAACCCTGCACTTTCAACCGATGCGTGGTACGGGATTAACTCGGAGACTACAGTGGGGGCAAT
CTCCTCTCGATACATTTCCAGCTGCGCACAGCTCCAACCTGAGCGGCGTGCAACAGCTTCGTACAGTACGCAGGGTGCCAGCTTTTCCCTTTTACGTTTG
CTGTTCTCCGTATCCACGAATTCCGGTGATGGCGCTTCAAGGACACGGACTTTACCCACATACTCTAAGCGATTGGCAGGTGCTGGCTTCAGTAGTTTGA
CGAACACGTATCCTTCAGGTGTCGCCAATAATTCATCCGCAGTCGTCGGGTTGCCAGAGGATAGATCCAAAGGGAGATCTTCCGTTGCCGAGCTGTTTTC
GACGTAAATCTGGCAGAACGAATAAGCATCAATGTCCACTCCGTCACAGAGTAGATGTCCAAAGAGCGGtcgatcttgaagagatTTCTCGCACTGGAGC
AGTTTGCGTGGTCGAAGCGCTTGACCCGACACCACCGGCTGGTTAAAGCACCACACTCGCGTCTTGTTcatcgctgcgtctgcttcactGTATTCTCCGA
GCACTTCGGAAAACTGATCGTGCAGCGCGACATATAAGtcgagcagcgagcagcagaaagGGAGTTCCAGTTCCGCGACGTTTGAGAAGTCTACGAGTCC
CAGTTGATGGTGTTCTCGGAGATCGCGCTCAAACACCACACGAAAAGTTATGGACATCAGCCGCACTTGGGCTGAAATCGTGAGTGTATCAGGCTGCGTT
TGACCTTCCGTCGTAGTCGTCAGGAACCCTTGCTGAGGGTCACGCAACAGAGCCAGCGAACCGAGTGAATGAACTCCCCAATTATTGAGATTTTTGTGGA
ACTTGTTATCCGTAAGACAGGAATGCCACTCAAGTCGACGTCTCGGATCCAAAGCATTTTCAACCTGCAGAGAGAAAACTGCGCACGTGAGCCAGTCCGG
AGGACGCATGGATAGATCCGTGAGTACGAGGTACACACTGAGAACGCGGCCTTTGTACTGTGCCTCGTTGGGGTTGCCGTTAGGAAATATCCAGAGACAG
AAGCGATGAGCACCAATTGTGAATGTGTTCGACACCACTTTTTCCATGTCTCTCATGGCTTCGACGTCGGAAAACTTGGGCACTTTAACCGAGATCTCAG
CCCTTTGTTCCTTGGCATGTTTCTCTACAAAACAGCGTCTCCAACAGCCTCCGTAGAGTCTCACCAACTGCACAAAAAAGCCACAACACAACATTCAATC
AGTTCAGACCTCTCCCACAGCTCGTATACTTCTAAAAAACAATAGTATATCCCCCCGTACATCATAGTCCGGGGCTCCCGGTAATTGTGGCAGCACGTGT
GTCCTCAGGCTCGGCCAATTGTCAATGCAGATTCTCTTCCACACCTCCCGGTCAAATGTCAACGCTCTAAAGGCGCGGCAGGTCGAAGCACACGCCAGTA
GCGAGTGACCGTCCAGCTGAGCAAGTgcgagcgccagcagctcgaccGGCAGTGTCTGAATGTCGCTAGCTGTAGCCTCGGGCTGCGTCGAAGAGGCGTC
TTCCAtttccacgtcgtccagacTCTCGCAGTCCGTTTCACCTGCGGATCCTTCGCTGGCACGACACTGAGTCAGGCGTGGGTGCTGCTTGAGGCGTCTG
TTgcccttgctgctggtggggCTGATCCactggcgcttcttgggGCTGAGCGAGAGGCTCGACGCGACCATCGACGCTTCGAGTACTTCCTTGTGGTGAC
GATTGGAATATAGATAAAAATGTGAGGTGGATCTTCGCGAAGAAGcgtttaaaaaaaatatggAAAGAGTTGAAGTTGAGGAAAACAAAGTCAAAGGATG
GTACGCACACTTCACAACAAGTTGTCAACAACTTCAAACGACCCATTTTAAGTACCAACTTTCGACAACGCATAAACATGAAAAGGCGAGATTTGGGTTA
CCATTTCCGAGATTTCCAAGACACGCGATGGCGCTGAGTAGGAACTTCCGCACGACCTACTACAAGACGCTGGGCGTGCCCGTCGTGCAGCATATTGTGG
ATGTGGACGCCTCGTTTGCGGCGCTACTCAGTGAGCGAACGGTGAACGTGTCCCAACTGCTGAAACtagcgctggagctgggcaTTGCACCGCAGCATCG
CGCGAAAATctggctgttgctgacgGGAGTGCTGCCGCCGTATACGGGCATATGGAGCTTTGCACTTAAAGAGAGGCGCGCCATGTTCGAGGATATTGTG
GGTGCAGCCCAAGTTCTTCAGGTTAAAGATGTTACGGGAGGTGACGAAAGTCGAGGGGTGTGTTACGACTTTATGGAGCTTTTAGAAGAGAaagatggag
aagagaaGGCATCTTCACCTCAAGAACTTACGAGACTGGTGCATTTACATCGCACGTATTGGCAAGAGATTGCAGCTTGTGATGCTCCAGTTCTGCTTGG
AATGCACGACCCGAATTTCCTCTTAGGCGTGGCTCGAGTTGTGTGTGAAGTGATGACACGGGAGGAAGAACGGTTCTGGTGCTTCACAAGGACGTTGGAG
TTATTTGATGACGgcctggagctcgtggaccCCTTGGTAACGTTGGATTCGCTACATAACCCTTCTCTTTCGGAGTTTGAAGGGGTTTTGCTGCGAACCG
TAGATGTGAAGCGTCGACGGCTGACAGCGGACGGGATGAGTATGCATATGCTCAAGTGTacgcatgaagaagagtaCGGCAGGCGAAGGTAAAGAACTAG
AATACTTCGTGAATAGCAATCAAAACTATGCTGAACGGCAACTACGAGAAgccttcgacgtcttcgtcttcgtcgtcgttgaCGCTATCGCTATTCAAGA
CCTCCCGCTTCTTAGTCTTGCGCGaaagccgtcgtcgcttAGGTGTAGTCTTTGGCCTTTTCACTACCTCCTCCAGATCGACATCCAACTGTTTTTGGTC
TTTGCGAGCCGCGGACCATGCAGTCATGAACAGATTCCAGTTGCGCTCGATTGGATCTTCGGATCGGCACAAGTCGTCCACGGAAGGTAGCAGCAATTTC
TTGGGGGAGCGTTCTTTTGCCTCGACTTGATAATCTGCGGATGATGGCTTGTACGTAGCGCACTTTTCATTGTCCAACTGGTAATTCTGCTTAAGGGCAA
ACTTTAGGCGAAGCATCAGCGCAATCGCAAAAGCAATAGCTCCATTGTTCTGCAAAGTCACCAACTTCGCACCAGCCACTGGCCGCAGCTTATAGTCGTC
AATCTTCAGTTCTGATAGATCCgattcatcgtcttccaACAGTTCCGGCGATACACCCGCGTTAGCAAATATTTCCTTGagagcatccagcacagGGCTA
CACAAAATTTGGATTGGAAATTGTGAGGGGTTAAGAAAACAAATACACAACCCCCAACCAATATTCTATACGTACCCAAGTCGAAGGCTCACGTAGCGGT
TGATCAAATAAATAACGTACAGGGGttcgtcctccacttcgaAAGGCAGCGCTAAGATAATTTGCGCTAGATAGCACAAATATTTCAGAGTACCCGAGAA
GGTATGACTGTCGGCGGTGTCAAGCCTGCTCTTCAATGGCTTGAGCACACTTCCCTGGTCGGTAAATTGATTTAACAATGCCGAAAGAAAACGTGGTGCG
TACGATTGTGTCGACTTCACGCAGCTAGTATATAGTCGGCCAAACAGACAGAAATCGTTTTGGTTCTCGTCAACTGCAAGTGTTGTAACGTTACCATATA
CGTTCTGCTGGAACGAGTACGAGTCACGAATACCCTGAATCATTGGCCCGTGAAATTGACTCCGAAACTTCTCATATAGACCAAGCAATTGAGAGAATGC
CGCGTCCCGAACGTCCGGAATTCGATCAGTCTCCAATGCCACCAAGTTAGGAATACATTGCAATGGATTCACCAAACCTTGGGTAAGCAAAGCACCGATA
CATGCGATGGCCTCCTTTCGAATTTGTGGTACCTTCTGCACTGATAACAACAATATGTTCTCCAACTCCGCCTGCATGACATTTCCAATCAATGACGCAT
CAGCTTCCTGATCACCTCgaacttgctgctccttgctTTTTGCCTGattcatcgtccgagtcgccaGCCCATTTTCCAACCGTTTTTCTTCATGTACCAG
CAGATCTTTCATGCTTACGAGACATTGTAGCTTCGCTTTGCGAGTATTCGCGGTTAAAAGAAAGTTTAACAAACCATCCTGCTGTGCTTGGAGAAACAGA
CGCGGCCTGACTGGAAACAGAAATCCCATCCCTTGTACTGCTTTAGCAGCGCATGCATCGTTGCTTGTCATTCGGACGAACTGCCCGTACAATCTGTAGA
GCGATTCTGTAATCGTTCCAACcttcgtcactgtcgctTTCGTAGCCAGTTCCGTGCAATTGTCGATGTCTGTGGCTCCAACAATTTTCCCCGCTACAAA
CAAAGCACGCTGGAGTACATAGTTGTCATGGTCCGTCAAATCGGCAAGCGATGCTCTCTGTTTGAACTTCGATATGCTGAGGAAAAAATATtccagcaac
tcgagcaATAGTATCGGCGCTTTGTTCTGTGCTGCTGAAAGCGTTGCGAGACACTGGATACTCGGACCAACAACGCTTGGGGCGGATCGTTGTACCAGAA
GTTTTAAATCGTTCTCCAGCCCAATAGTGACACTCTGCGGAACGCGTTTAACGCGCAAAATGTTATTGATCATAGACACCGACAAGCTTTGGACTTTTGG
GTCTGTTTCCGTTAGGTATATTCGGATCGTCGCGAGATGGTGGGCTAAAAGCTGAGGTTTCGCTTCGCAAAAGGCATTCAGCGCAACCAAGCAAGTAACA
AACTGCTGGTGTCTGTCTTTTATCGAGACACCTTTCAGAAGTGCGTTCTCTTTTAAGTCCATGAGGCATTCCACCAATCGATCAACGATTTTTCCAGAGC
GGTCTTCAGCAATTTCAACTTGAGATGGCCGACGCTTCATGCCTTGCAATACCCTTTTACTCGCGTTGTTACTGCGTTCTGCCAATAATCTTTTGAGTAG
CTCCGTAAACCATTCAATTTTTGGCACTTCATGAATGACCTCAACAATGGTTGCAACAATCTCTGTGCTGTTGTCGAGCGTTGCGTCCTGCTTCCTTACA
ACACTGGCTGGTGTCACCGCAGGAGTTCGATATAGAGACCACGCTTCTTCAATCGAGTTAGCGACATTCCCATCTTCTGAAACAAACTTCGTGTTTACGA
AAGCAGAGTCAGTCTCTTTGTGGGCCATGGCTGTGGCAGACGCCCAACCAGGCGGTAGAGTATTTCCATCGCCAAATTCGCTTAAAAGTCTAGAAGACGA
AAGTTCGGCGCCAAACCATACCTCCTGAAAGGTATCAATAACGAAATTTTTGATACCTtgatcttcagcagcgtgcCCAACTCGTTCAACAAGACAGCGC
ATACACGCACTCTTGCgtcgaagttcttcttccgtgaTACTATCATGGGACGGATCTTGCAATGAAGTCAACGCTATCTTGAAGATTCTGCACACACTCT
TTCGAACTTTAATTCCCTTGTCTCGTACCCTTTCAGCAAGTGTGGCGAAATACTTGTCAAACTGCTCACGAAGAAACCAGTTTAACATCAAACCAAATAT
TGAGCCCAACAGAAACAATAAACACCCGTACCAGAAaaggctgaagaagaacataCGTCCCAATCAAatccacagcagcttctcgaacggAAGGTTTTTC
GTCCAAGCAACATCTTTCAACGGCTCCTTGTACTTCCCTTTCTGCCATCAACATCGGATCAACGTCAACAATGCCTCGTAGACATTTCATAACTCGCGCT
CTAAGACTCGGCATTCCCTTAGAAAGCAGAGCCATAACATGAGCTAGCAACTTGGCAAACGATCCACAAAGCCCCCGTTTTACGGCAAGGTGTAAACTGG
AATTCAGAGCCAATTCAGTCGTGGGAGCAGCTAGTTTAAACGTCGATTTTACACCTCCGGGCGACGTATCCCACAGTGACCCCCACAACTTTATCTCTCG
CTCCACACATACTGACGAGACCCCACTCCAATGACTCTCCGATTCCGTCATGAATGTCAGTAAAAGTAGTCTCTTAGAATCGCCATTTTTGAAGTTGTGC
CGTTGGAGATGCATCACAACAATATGCTTCAGCGCAATCcggcgaagcagctcggcgtcAATACTTGGCAGTTCAGCTTTAAAACTCGTTACCTTACCAG
CAAGAACCCCACGCAAATAACTTGTGTGTTCTTCGATGATAGCTTCAGAATCACTGTCGTCCTTTAGGTCAACTTCCCTCTGATATTGTTTAATCGAAGC
ACATATTTTCCCGACCAAGTTGAGCGCAGTCAAGCTTTGATGTGAATCCGGGTTCTTCACATCTGTGGATATATTCGCGTGTAGGATACTCGCCAGTGAG
GAGCTTAACACCTCTAAAAGGTATTCTGCGCCAATCCACTCGGGGCGTACAAACATCACCAGAAGGTCTTCAACAAAATTATCTAAGACCACGCGATTGT
CACGCTCTTCAGATTTCTTCCAGCAGGCGTTCAGCAACATCCGAACAAATTGCTGCGCTATGGCCCGCGAATCTTCCAACATGTTCGTTACTCCATCACT
CTTTAGAGGGTGTTCAATGACATCTGGCGTTGCCACTGGGTTAATCGATTCTTCGATGTTCTGAGTTCCAGGTTTTCCACCAGTAGCACATGACTGGATT
ATTGACACCACTAATGTTGATATACGCTGCACTGTCTCGTCCGAGTTCAGTAACCTTACCATTCGAAGCGTACGTTTGGCAGTAGGAAGCTTAACCATGA
TCTCCACAATATCACTTAGCAATGACTCACGATGAGGCTTATACTGCAGGAATATAGCTCGTAAAATACCCAGGGCGCTCTCCTGCAACGAGGTAGCGTA
CGAGCTGTGGTCCAATGCAAAGAGATCCACCATTGATGACGAAAGACGGAGAATCCATCGATCTGCGAGCTTTACACTCAAGACTAGCGTAGCGAGTTGA
TCCATAAACTCGCAAGCGGCATGCAAGACACGCTCAACAGCTCGACGAGTACATGTGTTTGCTTTCAAATTTACTCGAGATGAGATCGATGTTTTGCGAC
CGGATAGTTGCCGGCGATCAGAATCTTTCGTCATTGGtattgctgcagtggtcGCGAATGAAGTGTCAATACAAGGAAGCAATACACGTCTAATAACGTG
GTGCAGGATTTCAAAGCAATTGTCAATTGTCTCCTCGGAAAGAACTCGTCGATCAACCTGAGGAGTTGTCATCACGATCAGCTCACAGATCGCAACATCA
AGTGATAATAAGAGCCGAAAAACCAGCCGTTCATCAATCTGTGCTTTCCCTCCTTCTTTTTGCGATAACTCGGACCCCAGTACATCGGAAGCTAAGCCCA
ATCGAACTTGTGCATCGAATGCGCTCATCAACGATATCACCAACTCTGGCTCAAGCTTATTAGCCCAGTCGCATTTTTCCATAGCTTTCATtgcctgcag
cagcattttaACTTCTTCTGCCTGAAACACATCCATGTCATTCCGTTCAAAATTGTCCAGTTGCTGGCGATTCGTAGATATGGTAACCAATTTCTCCAGT
AATTCGGCATACTTCTCCACAGTGTCAGCAGTAATGTTCGCCTGAGTGACAAACGttggaagctcttcttcattttccaCCTCTGGGTTCACGTAAAGCT
CGTCATTCAActcatccagcacgtcgtgcagGTTTCCATATTCATTTTCCGTCGTGTCTTCACATTTCACATCTTTGGTAGATGACCGTCGCTTCCGTGG
TGGCTCAGATCCTTCATCGTGCTCCAAGTTTCTTTTCAATTTGCTCGTAGTCGTCGGTTTCGCTCCAGCTAGTACCACATAATCACCAAGCCATTCATCA
GCTCCACAATCAAACAAACCCTACGAAATGCTGTACAAACCATTGAAACATCCTGTCTGCACCACAGCCTGTGCCCACTTGGGCAGCGAATTTAACACGT
CTGCGTTGATTTCTGTCGTCTCGCCTGCCAAACTGTAGCACCATCGCAATGTTGTTAATACTTAATTAATATTAGTGCGTTGTAGCTTAGTGCACCTGAG
TCTGCCGGTTGTCGAGCGAAGAATCGTCGCCAACCGCTGTGGGTTGATCAACTCGGTGCCTGCATCAGGATCGCAGGTCACTGGGTACAGCTCCTCTTGT
GCatccgctgcagcagcatctgctggGTCCACATACAGCGGGAAGAGGAACATCCCGCCCTGCATCGTCCTCGGGCAACGCACGATGCGGAATGAGAGTG
ATTGTCGGCAATGTTCAAAGTAATGTTGCTCCAATGTTGCACCAGCTACCTGCCGAATGATTGATTGACTTGGTCACAAGAATTGATGGATCGCTTCTAT
TCAACTCTTTGTCTAATGCAGTGTATGTATGCTGTATTTTGAATTGGTGGGGCCTACGCAACCTTTGGGCGCGTGCTGGCAGGCACCGAACGCTTCTTTC
TCGCTCCAGACATAAGAGCTCCCGACCGGAAGATTGCGTACATGATGCGGAGCTATCAAAACAGCTCGAGTTAGCAACTTTCTCCAACTATAAGCTTGTG
AAGTATCTAGCTCACCGTGTTCCAGACCCAGATGCAGTGCAGCACTAGCTTGGTCATAGGAAGAGACAACATATCGCTGCCTCGGGCAAGATGTACGATG
GGAACGATCACGTCGCCATACAACACGAGGGAGGCTACAAACAGCATCAAGCGGATAAACTGCGCCTGGTCATTCGCTCTGTAGATTGAAATTCAGCCAC
ATGCTCTTACCAGTGCGGTGCTACGGAAATACACCAATAACgttcctcctgcagctgctaaTCGTACAGCTTCCGGCTTCTCGTAGTCTAGAATGCAGAC
AATGGCCAGCAACGCAACGACAGCCTGCACACACGTGGATTATTATAGTCGTTATTGCAGGCATGCCAGCCTACTCAATGCATAGTACACTACCAGCTGG
ACGTAGATAGCGACATCGATAGCTCGTGACCGACCAGCAGTCGACGCTGGACCCCACAAGGTGCGATCCAGCTCGGTGTGATGCAGCACTACCATCGCCG
ATTCTCCTGTATCAGAGTAATACTCTCTCTATAAGGACGCATAAACCCTTTACAGGAGCACGCTGGAATTTACCGGTACAGCAACTTCACATGGAGTCAT
TTTTTCAACCATGCGAATTGAAAGCTATAGTCTGCACCTGCAAGTTTTAGCAACCAC