Description :
From Genome Similarity Track
Location :
Scaffold_3:1436334- 1437908
Transcript NameFunction/comments
Physo_493164conserved unknown protein

Sequence
1574 bases(100 bases per row)
AATACGGTGGAGGTATTCCCGCAACGTGCCACTTGTCGCAGTAGGTCTCGCTGTACACTCATCTAAATCAATATGTTTGCAGAAGTAGCGCGCAAATCTT
GAGAGCTTGTTGTACTTCCTGTGCGAGGTACATTAAAATATACAGCCGGGACTAGCCCGGGGACGCCTGTATTATCACTTTTCATACTACAGTACGAATC
GATTGTGGCCATCACGAAGTGACACTAAATGAACCTAGAGAATAAATCACAGAGTAAGTAATGATTGACGGTTCCATCCTTCTGCATTTCCCTTCTGTAC
CGCGTAAAGATGATCGATGGCATTCCTCACCTTCCAGCTACCGTCAACGACTTTCTGGGCCCCCCTCCGCCGACCATTGTGCACGTATGTAAACAGAATC
ACTCGTCAATCTGCGCCGTGGAGCTCAAGTCGCCGGGAGGACCAATCAGCGGGCAGTGCGGCGATAGAGCCAGCTGACCCAGCGGTCCGGCCACTCAGAG
CGCGCCGGTGAGCATCGAGAGCGCTCTGATTGGCCACGACTGGACGACGGCGACTCCCTTGTGGAGCCAGTCGTTCCTGGCGACCGGAGCTCCAGCGAAA
GGCATGCACCTGGCCGGCGTGCTTGCACGCCACGGCTGGGCAGCTCGGGGGTGAAGCCGCGGACCAAGCTGGATTTCTGCGTCGCTGCGTGCGGCGGCGT
ATTGCGGCGGTCTTTTGACCGTCGGCCGGAAGGCGGGGCCTGTGGGGGGTCCACGGTGGTCTACATGTAGCCCATCGCGCCGTTTCCCATTACAAACCAG
GCCACGGGTGGCGCCGTGGGCCTTCCTGGTAGTCATAGCCTACAAAGGTTGCGTGCGATACTGGCAGGTCTCCAGATCGTCGGGTGTGCAGCACTCCAAC
GTGCGCACACCCTCCACACTATTCGGCGGGGCATCGGGAGATATGAGCTCGGTGTTGACGGTGGATGCGTCGGTCGTTATCTTAGTTAGGATAAATGAAC
TCAATCTAACCTCAACCTTGAAATGAAACGAAAAATGTATGTATACAGAACGCACCGAAGCTGCTGTGACGGGTTGGGTCAGACGAGCGGCCTGAACCCC
AGCCTGGCGAAGAATGACGAAAGCGAGGAGCGGCTGAGGGACGAGTGGGACGTTGAACCCCAGCGGACCCCGGAGACCACACGGTCGCCAGGATCTGCTG
CACCTGTGCGGCGGGCATGGGACTCAGGACCTCGAGCATCGAGCTCACTCTTGAAATAGACGGCGAGGGCGCAGAGGCCTCGGCGACAGACGCAGCTCGG
GAGCGAGTTGCAGGACGAACGAACGGCTGCTTCGGTGGACGTGCTACTGGACGACGTGGTGAGTGACGGACAGGAGAGCCCTTGGCACTCCGAGTCTTCT
GTGGACTGCGAAGTGAGGACGGGCACAGCGGTGGTGTACGTCCAAGTGGTTTAGAGGGCGACGAAGTTGTTCACTGCGTACGTGTCTAGGAAGTGCGTGT
ATTGTTAGTTAGTCAGCAGCGCCGGCTGCTACGAGTTTGTCTTAGTTTAAATAAAATTGGTTGCGTTGCCAGTC