Description :
From Genome Similarity Track
Location :
Scaffold_932:14362- 16696
Transcript NameFunction/comments
Phyta_totarag11415hypothetical protein

Sequence
2334 bases(100 bases per row)
ggTGACGTCCATGGCGATGTCGAGGGTCGGATGATCTCGGCTGACAGCAAACCCTTGATCAGCAGGTACAATTTCTCGCGGAATTGCGGAGCGACTTTGC
GGACCCGTTGGGCTATTGGTCTTACATTTTCCACATTAATATCGCCGATCGCTCCCTTCGCAGCAGGTGGCAAGGCGTTCCCCTTCCCAATTAGAAGGTG
TCGGCGACGTCAGATGATCTTCACTAGtcgctcgatctcttccgGCGTGCTGTCCTCAGGGTTTCCACTTGGATATCCTCGATTTTGACTTCTTCCGTCG
TCAACGTGATCTCCGGCAATACCGCCATGTGCCCTTCGAGATCTTCTGCATAATGCTCACCTCCTTCTTTGATGCACTCAtgttcgtcttctgcatgtTC
TCTCGCGTAATTATCGGCGAGATCTTGTTTATTCTCGTCCGGGTCTTGTCTCAGGGTCTCAGATTTTTATCTAATCCCTGCAAGTCGATCTTGAATGCGT
TTCTGATTTTCACCCGTCTCTacacctcgatcttggcaATGACTTGAATCCTGACATCTGAAATCTTTTGCATACATCGCCCTTTCTGCACCTGGGACTG
GGCGCTTTGTACACTCATCGATGTTGTCGTGTACCTTCCCAGCCGGCGACAGACCCGCGTGTTGTCGCGTTTCTTCCATCGTTGGGGCGCCTTCTCGCAT
AGTCCTTCGGTCGTGttctccgccatctccatcgtcaccaccgccgagCACTGCCACTTTTGGCGGCCGGGGCAAGATCGTAGCCGGAGTCTTGTACTGT
GGCCGATCCACGGCGGGCTCCTGTGGTTCCTCAAGTTCCTGGTGATCTTCGCCGATATCCACCGTCGCCTGGTAGGCCAGGTTCTGCCATTCGGCATACC
TGCGCGATCCTACCGAGACATATCCAGATAAGCGGGGTACCCGATCTCCGGCCAGCCACATTCCGACGCGCATGTTACGATTCAGAACTAACTTGCGATC
GCTCACGTTTGTCAGCTGCAGGTAGTGTGTCTTGCCAGGGCCTGCTATCAGGGTAGACACCCAGCGATCTCCGCGGGATACCCACAGCTTCCGACTCtcg
gcgcgcagcttcacctccGTCGATCCTCCCACGTCAACGTATCGATCTTCGTTCAACGTCACCTATTCCACGCGATCTCCATAGAGTGGTCGTCTACCGG
CTAGCTGGACACGGACTTCGATGGGGAGACAGATAGTGCCATCggcaagatcgaggcggatACCGGCCGGGACTATGCAGTCCATGCCGAGGATCAAGTC
CTGACCGCCAGTTGGCGGGCCTACACAGACGTCGAAGAAATAGAACAACGATCCAGCAAGCGTGATCTTGAGTCTGGTGCGTCCGTCCGCCGTGTATGGG
GATTTTCCAACACCTTCACATTCCAGTGTCTGACTTTCGTCAATGTAGCACCTAACCTTACGAGCAAAGGCGGTGTCAATAATAGACACCTCGGCACCAC
TGTCAAACAACATGGTTGCTTTTTCGTTGTTGATCTTCCCCACAACTTTCGCTtgcttgaacttcttgtcaGGCACGTGGTACTTCCAGTATCCACGCGA
TTCTCCTGGCGAAATGTCCAAGACCATCGTCACACTTGATCTCGAATACTCATCGATCTTGTGCAAACTTGACACAGCAGCGGTAGGTTTCCCATGAAGA
TCACATGTATTGTCGATCGGATTCATCAGCTTGCTAACCATCGACTCCGATTGTTTCTCGACATATGCATAGACGCAGTATCTAGAACGCTCGTCTCGTA
CCGGGTTCAAAACCGGCGAGCGTCCTAGTTTAACATCTTTTCCGCCGTCTCGGCAGCATGCCTGCGTGTTTGGTGGGGTTGAACCACTGGCGGAACAAGT
TGTAGAACTCCTCCATCGGGCATTGGCCAGCGTCGTGGATCTCACCGCAGGCTTTGCACACAAAGAAGCATCGGTCGGATGGATGTCCCTTTCGGCCACA
CTTCTCGCAGGTCAAGCGTCCCCAGCATCCAAGATCAGTATGCTTGCGCGACCCGCAGTATGAGCAGCGCTTGAACGACGCCGCCAGGTCAGTCGATCTG
GTGTGCCGATCTTGCTGGTGGTTCCGGGTCGCATGGCCTGTACGGTCTTGATCCGGTGGCCCACGATCTGGTGGCTCGCCATGATTCTCAGCTGCCGTCA
GGTAGACTCGGCGCAGTCCTGCTTCGCCATCCGATCCGCTCGACTCCGCGTCCGACTAACTACTCTCGTTTGCCACGTGGATCGCGCGAACTGCTCGCGT
GGGGGCTGACGGTGTGTCTGCGGTCGGTGCTCTC