Description :
From Genome Similarity Track
Location :
Scaffold_20:143611- 145579
Sequence
1968 bases(100 bases per row)
TCTCCGACTCAACAGCTGCTACAACTGTTGCGTGGAATCCATCGCGACGCGGCTGCTAGTGACCGTATTGTCACTGCTACTACATGTCGGTCGTGAACGC
TGCCTTTGGTTCTGCTCCCTCTCCCCGCGCGTGGAAGTGGTGACAGCTGCATCATTGAAGCTTAAACGCTCATTGCCACTGCACGCAGTTGCCAACATTC
TTGACGTAGTCTGTTTGATCCACGCAAAGATGTTCAAGATGAGGGTTACCGGCCATTACATGCTGATTCTAGATGAACTTCATTTTTAACTTACTAGCTC
GCTCTTTCACGTCATACTCTTCTAGATTGTTTTGAGCGACCTTTCGATAAGTACAGCTCCAAGTTTGTTTGTTTTCTAGATTCTCACCAAACACACACTT
TTTCGAATCCATACCACTTGCAGTGGTGTACCTGCATATCTAATACTAGGCAGGTACGATTGTACTACTCTTAGTATTAGCTGGTTCCCAACTGCAACGT
AAAGAAGCTACTTGATACGAACTTCCTTCCTTGCTGCAGACTGCACCACGAAGTGTCTCTGAACTGCAGCTTGCGGTTAGGAGACTCAGGTGATGATGTT
CTCTCATTCTGGCATTTTTCATTTCCAAAACAGCTATCTACTTGGCACTAGCAACTTGGAATTCACTGAATGGATTGGCGCCTCGACAAGGCAGAGGTAA
CTAGTGTGGTGCTAATAGCGAATCTAGTTTTCTTACTGACATACACGTCTTGCAGCTACCTTTCACTGCAGGAGTTGCAGCGTCCAATGGAGAGCAGATT
TACAAACCGATCGTTATAAAAGACGCGCTTGTTCATTTCAGCTGCCACCGCAGACTCAACTTTGACTCGTTGCTTCCCGTGTTTATACCAGCAAAAGATC
GAGTACTGCGTCAACATTCAAACTGAGGGTGTCATGGATACAACTGCTAACATGCAAACGTTTTTTTTAATTGCAGGTTTTTGAGAATGTATTCCACTCA
ACCAAAGACGTTGATGACTTTATTGAGATGTTGCCGGTAAAGGAAATGTACGTTATGAATGTCGACCATTCCAAGGATCCATACAGCGGCTACTACAGAC
ATCACTTTGTGTGGATGGTACGCTGGCTGCAGCTGTGTATGGAGCTTTCAGAGGTACGTAAGACCAGTCTTAAATTCGTATATGTTATGATGGTACTAAC
ACCTTTTCGTTACTACAACGTTTAGATAACTACCGAAATGATACGTGACCGACTGCAATATCTGAAAACATTTCTTGTCGAAAAAGCAGAGATGCTTGAT
GTCAAAATTGAAGTCGACATCCAGATGGCAGACGTTCGGAGCACCGAACAGAGAGCTCAAGCTTGGAATGAAGGTAAAATCTTGGAGAACGCATTCAGCA
AAGTTAATAACTTATGGATTGCGATGAGCGAAATTGACATTCTCGCGGATCAGTTCGAATATATGGATATACGAGAGCCATGCACGTGCAGCAAGTGTGC
CTACTATCGATCGCCATTGTGGGAGCAAGAGCAATCTGTCGGTTTGACATATGATGTGCTAACCTCCAAGCGAACCCTACCATTGGCTAGAGAAATGGGA
TGAGAAAGAACGGTATTATTTGCATAAATACCTAAACTGAATGAGGCAAAGGCAACCTGTACGAGCTGTGGCTCGAATAATAATAAAAATAAACAATTTG
GTTCATATACAGTGACATGAGGGCAGAGTATGATAGTCAAATTGTCGTATGATCGATCCAGAGCAGCACACAGGACAATAGTTTCAACACTCAAAACGAT
ATTTACAATACCAGAGCGCGTGGTAACACAGCACCACACAGATCACCGCTCTACTCAGATTATTCCCACAACGCCGGTGCATTTCCACTTCGCCATACAG
GGTACCTACTTGCTACTTGACTTCTGCAACTGAGGAATCAACGCTCAGCACTACGAATGTGAGGGCCT