Description :
From Genome Similarity Track
Location :
Scaffold_666:14361- 15832
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_666-snap-gene-0.8Aspartate aminotransferase

Sequence
1471 bases(100 bases per row)
GGTCCACGGAAGGCGATCAATGGCAAGATTCGAATGCTTTGCCACTCcGCTGGAAGCGCTTTGGACGAGCTCAGCAACGAGCTAATCATGGAAGGCAAGT
GCGTGTACAAaCTTGGTCTTGGTCAGTCTCCGTTTCCCGTGCCGCAGTGTATTGTTGACGAACTCCGGTATGTGGAAATGTATGTATGCACCCTATAGTG
GTTCTGTACTGATCTCTGACGTCAATACTCTGAACTGCAGTGCAAATGCGCATCAAAGAGATTACTTGCCCGTTGCAGGTCTTCCTGAGCTATGTGAAGA
TATTGCTGCGTGGGGTTCAAGAGCACTGAAGTCGTCTTACACGAAAGACGACGTTCTCGTTGGACCTGGAACAAAGGAACTCCTTTTTGTGCTTCAAACT
GTGTATTACGGAGATCTTCTCCTTCCGAACCCAAGTTGCACAAGTTACGCGCCACAGGCGAACATAGCTGGACGCAATATGTTCTGGCTACCGACGTATG
CCGAGGATAGATGGGTTCTAAGGCCAGAAGTCCTCGAAGAGCACTGCTCCAAGGATCCGAAGGCACCGCGAATATTGATACTCAACAGCCCGTCCAATCC
AACGGGATGCGTTTACAACGAAGAGGAACTCCAAGCGGTTGCAGACGTGGCGCGGAAGTACCGAATGCTTGTGATATCTGACGAGATTTACTCGGAATTG
CACCATTCCGGCGAACATCACTCGATATCAAGGTTCTACCCTGAAGGGACGATCGTctCAGGAGGCCTCAGCAAGTGGTGCGGCGCCGGAGGCTGGCGCA
TGGGGTTTTGGCTGTTCCCGAGTAGTATGGCATGGCTGCGGAAGTCAATGCTCGTTATGGCATCGGAGACATATACCTCGGTTGCATCCCCAATTCAGCA
TGCAGCACGAAGAGCGTTCGTATTAGAGTACGTAGCCGCGCGATTACTGATCCCcGTTGCTTCTGACGTTGAATCACGTGGACAGCTGCATCGAGCTCTC
ATCGTACAAGCAAAAGTGCTGCAAGaTCCTCAAGATCATCGGCCAATGGTGCCACTATCAGCTGAAAAAGATGTGTGTGGATGCACAACCTCCAGAAGGC
GGATTCTATCTATTtCCATCTTTCGCACGTCATCGGAAAGtCcTCATGGACCGCGGAATCACCACCGATGTTGAGTTGTGTCATCGCCTTCTGCACGATA
CTGGAGTtGCGATTTTGCCTGGATCCGCCTTCGGACGAAaCCCGCAGGAGCTATACGCACGCCTCGCATTTGTCGACTTCAAGGGCGATATTGCCTTGTA
CCTTATCGAAAGCATGGTATGTCCctGTCCATGCGTGgTGGAAAGAAGCAATCTCACGAATTGATTGTTATCTCAGCAGGACAACTTTGGATTGgAGGCA
ATTGACGCCTTCATTCAGTCAGTATGTCCAAATCTCGATATCGCCATGCGACGACTATCATCTTGGATTGC