Description :
From Genome Similarity Track
Location :
Scaffold_6:143608- 145277
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-1.35Ankyrin repeat and SOCS box-containing 8

Sequence
1669 bases(100 bases per row)
CGTCCATTTTCGCTTCTGTGATGAGGAAGCGTACGACATCCTCGTGGTCTTTGCGGCAAGCATGATGAAGTGCGTTTCGGCCATTATTGTCAACGACATT
GACCGATGCTCCTGCCTTCAAAaGCTCCTGCACACACATCAaCTTGCCTCCATAGGCAGCTGCATTtCCTCAACCCATCAGTTTtCCAATCACCTCACGT
CAAATAATCATACCCCAGTGCAGTGCTGTCATCCcAAACCGCTGGACACACTCAGGATCAGTGAGCAGACGATATGAGGCCAGGCCAACGTATGAGAACC
CACATCCTGAGCGTCTGGTGACAGCTTCGACTGCTTCaTTATCTCCTGCATCCTCACAACGTCACCCGCGAACGCGCACTTGACAAAGACTAGCGTCTTt
GCCATGCGACGGTCAGCACGTTTGAGCTGGAAGCTCGCGATCGCACCCATCACGTAAAGCGAGAGCAGAGATCACGCCTGGATGAACACAACGCTGTCTT
CCTACTACTGCTGTACGCTCACTGTCAACGAGGTGCATCCTTAATTAGGCATGGCGACATGGACTCAAAGACGAGCTTACAGTAGCAAGAACGCTAAGGA
CTATTGGTATTGCTCACTCCAACATGGAGAGGGTGGGAATGAAACGAACAAAAGGTAGGACGACACATTCAGCTACAGCTGTCTTAGACTACAAGCGTCC
TATGTCTACTGTCATGCATATTCGAATCGATTTGATATGTTTGCTCTATGGTTAGTCTCCAGCATTATGGTCCGAGTGACTTGCATAGAagACTGGGAAT
ATAGAGCCATCAATCGGTGGAGCAGCGATTCCAGCGAGCGTGCGCAAACGTCCGAAGACGGCGCGCGACTGCCAGCGGTCCTGCTGCTCAACACCGAGAC
TTCGCTATTCAACTGTTTGCTTCGACTTGTCCCTTACAGATTGCCACTGCACTCGAGAGCGCAGCAGCCTCGGGGCGAACTAGCATGACCCCAGGATCCC
CCTGTGAACGAAAGGATCGACCGGAAGTCCAGTTGAGTGAACACAGTGCACATGCAGTGGAAGTAGTTAGGCAACTCGCCCGAAGACGGCAAAATCCACA
GTGAGCTCATGGTGGAAGCAGCTCCATCGTCGGCGTAGCTCTTCGGGGCAGCCAGTCGTTGGTGCGAACCAACGAAAACGCCGTTGGGTTCTGGAACAAC
CCGGCCCGGACACGAATTTCTCCAACCCGGCCCGTCTCCcTtCCCTGCCATCGATTGGCTGGTTGGGGTTTCATGTGGTCCACATGGTCGGTTTCGGCAC
CAAAGACAGCGACGGCTTTCACCGGTTGTGACACCGGTATCAGCTACATGGTGGCAGAGTCGGTGCAGATGCGAACCCGCCCAGTCACGGGCCTGTCTGC
CCATGGCCCCAGCGGAACGCACCCACACTCGAGCCTCATCCTCAAGCCAGCGACGCCACGACGGACGCCGCAGCTGAGGGCGGAAGAAGCGGCGCCGCAT
CCAGGGCTCTCTAGGTACACGCTACAGTATCATCAGTCCACGCAGGtccccccccccgccGgCGCTTGAAGTGGCGGAGCGAGGgAGCGACcGACAGCGC
CAGCCAGAGCAGTGCACGACGCCCGCGATGGCGCCGGCGTCCGAGAAGCACGCCGAGGCCGGGCAGACG