Description :
From Genome Similarity Track
Location :
Scaffold_2623:1436- 4342
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2623-snap-gene-0.2Appr-1-p processing enzyme family protein
Pytiw_DAOMBR242034maker-piw_contig_2623-fgenesh-gene-0.1Nucleoporin 43

Sequence
2906 bases(100 bases per row)
TCGACGCGGTGCTCAACGCGAAGATCTCGCTCTGGAACGGTGCAATCTGGCGCCTGTGCGTGGGCGCGATCTCCAACTCGACGAGCGAGACGCTCAAGGA
CACATCGGGGCTCTGCCGCAAGATCCTCGACGCCGCTGGGAAGGAGATCTGGGTCGAGTGCGCGGCCGTGGGCACCTGCCGCACGGGCGAGGCCGTCGTC
ACGCGCGGCTGCCAGCTGCCAGCCAAGCACATCATCCACACGGTCGGCCCGCGCTACAACATCAAGTACATCAACGCAGCTGAGAACGCACTGCACATGT
GCTACCGCAACTCGCTCTCGGTCGCCAAGGAGGAGCGCATTCGGACTGTCGCGCTCAGCTGCATCTACACCAAGCGGAAGGGCTATCCGCGCGACGAGGC
CGCCCAAGTCGCCTCGCGTACAGTGCGGCGTTTCCTTGAGCACTACCAGTCGGACTTTGACCGCGTGATATTCTGCGTCGACACGCTGGAGGACCAGATG
ATCTACGAGTCGATCCTGCCGCTCTACTTCCCACGGACGAGAGAGGACGAGCTCAAGCAGGCGACGCGACTCGCGTTGCGAGACTTAGGTGTGTATGGCA
CACTTAACCTATTATGTCCATGCTCTGACATGACCGCGTTGTTCGTGTAGGTGACGAGTTTGGGGAGCCGATTATCGAGGAGCGCAAGATCCGCATCCAG
TCGCTCGGCATGCGAGAGCGCGTTGTTGATAACCAGACAGGGTGTGACGGAGGTCCAGGTGGCGATAAAGACGATACCGGAGATGGTGGCGAGTGGCTTG
TGGGATTACTTGTCTATCCACGAGCGTAGCTAACCTATGACTTTTGACTTGTAGACTCGACCGACGACGAGGAGACCGCGATCCAAGACTTTCGAGAAAT
GTCGATCGACCCCGACACGGAGCGTCTCGAACGTCTGCGTCAGCTCCAGGACGAGCGAGAGAAGCGTGCGTTGAAAGCGCAGGCCGCTGTCAAGAATGCC
TCGCTGGCGAACTACCAACTGGCACTCTCCAAGGCGAAACGAGAGGACTTTGAAGACCTACGCCGGCTCAAGTTCCTCTACAACGGCGGAGTTGACCGCT
CAGGCTCGCCCGTGATCGTGTACCAGGGCGCGAACCTGCCCGTTGATGCCGTGGACCTCGACCGCGTGGCGCTCTTCATCATCCAGAGCATGGACGCCGT
GGTGGAAAACCAGTACAGCGTGCTGTACATCCACGCGGGCGTAACGGACGAGAACCAGCCGAACGCGGTGTGGCTCAAGCGCCTCTTCAAGATTTTCTCA
TCCAAGTACCAGGTCAACTTGCGCTTCTTCTACATGCTCGAGCCCACAATCTGGCTTAAGCTGCTCATCTTCGTCTCGAAAGGCTTTGTGAACAACGCGT
TCTACAAGAAAATCGTGTACCTGGCGTCGTCAAAGGACATTGACAACATCGCCGACTCGCTCGAGCTGCCGTCGCACATTTACCAGAAGCGAGAGAGCGT
CACGACGGCCAGTGAGGATGAAGACAACCAGCACCAGTCCGCAGAGACCGAGCCAACGAACCAGAGCGGCCACGAAGCTGTGCTGTGACGTGTAAATGCG
TGGAACGCCGCGATGCTGAACAAGATCTTTGAATTTGTTGTGATCACATTTTCGAATCCCAACAGAGAAAGACTCGGCACCGTTCGATTTGTCCACGATG
GAACGCGCACTTCAGCGATGCACTTCGACGATGCCGCTAGCGATGCGGCTGAAGTGTACATACTCATCGTGGACAACTCGAACGCTGTTGGGCCTTTCTC
GAAGCAGTTCCTAGCTCTCACACTTTTTTCTATGGGAAGCGCTGCTGGAGCTTGGACGCGTTCTGGACGATGAGCACCGACTGCGCGTCCGAACCAGCGA
TCAGCGTGTCCGACTCGGCGTGGATGTCGATGGTGTTCCACGGGAGGAAGCCCCCAGCCACATGCTCAACCTGGAGCGACGCTGGCTGCTGCTGGTGCTC
GACACTGTTCCGGAATCCGTTGTCAGCAGCGGAAGCACTGGCGTGCTTGTCGTACTCGACGGCGTCGCGCACGCGGCCGCCGTGGTGGAAATCCCACGAG
AGCACGGCTGAGTCATCCCCACATGAAAACAGGAAGCGCGGGCTCGCGTTGTGGAGCTTTAGCGCGCGCACTATGATGCAGGACACTGTTAGCTTTTGTC
CTCTATACAAAAAGAAAATACAAACGAATGGTTGGTCGTACCTGCGCGCTGGTGTTTTGTCTCGGTGCGGAATGGCGCGTCGAGGCGGCGTTGGTCCCAG
AAGCAGACGCGGCCGTCGTCCGAGCCGGTGATCAGCAGCTCAGGTCGCGTCGGGTGGGTCTCCACACTCGTGAGGATCGCTCCGACATGCGGGCTATACA
GGATAACACAAAGTGGTCATTGCTCAATTCTTTCAGCATCAATCTTTAACAAATACTCATTACGTACTCGGAAGCAGTGAGGACTGGGAACGACTGGTTC
GCAGCGATGTCCCAGATGCGCAGCTGGCTTCCAGGGGCGGATCTGGGAAGCAAAATCACAATGTCAGCCTCTCTCCTGGTAATTAACAACCGTCACAGCG
ACAACACGCACCCAACAGTGGCGACGATCGAGTCCTGGCCGAGCACCTTGATGCCGTTGATAGCGAGATGGCTCGAGCCCTTGTTCACTGGTTATCATCA
CGAATTTAGCCAAACACTGAGTGACCGTAATGCAATATATCAGCACACAGGACAGTAGCTTACCGATCTTATTGACGCTCATCGCGTGGTCCAGTTTAAG
CCACGCGACGCCCCCTGACTCGCTCGCAGCGACGATCGTGGCCTTGCTCTCGCTCACGTCCAGACACGTCACGGGTGAGCTTCGGAAGAGGTTCTCCCAT
TGCGGA