Description :
From Genome Similarity Track
Location :
Scaffold_1138:1436- 3175
Transcript NameFunction/comments
Phypl_g125266,7-dimethyl-8-ribityllumazine synthase
Phypl_g12527flagella associated protein

Sequence
1739 bases(100 bases per row)
CCTTACGCCGCCAGCCGCCTTATCGTGTCgcagaagctggacgccgtcatCTGCGTGGGAACGCTCATCAAAGGGGACACGATGCACTTTGAGTACATCT
GCGAGGCCGTCGCGCAGGGCATCatgcgcgtgcagctggacaCGGGCGTGCCCGTGCTCTTCGGCGTGCTCACGGTGctcaacgagcagcaggccaagga
cCGCGCCGGCCTCTCAGACAAGGGCCATAACCACGGCACCGAGTGGGCGCAGACCGCCATCGAGATGGCGCGTCTTCGCGAGGCCACGCTCAAGGGCGGC
TGCCCCATGCGCCCCCACGAGCACCTGCCCCACCACAGCCTGACCAACTGCCCGTTCTTCACGGTCTCCACGTGGCTGCACATCGCCACcctcggcgcgc
tcggcttcgTCGCTGCCTCGGTCGCCAAGAACCTCGCCTAGACGGGGGAGGAGCACGCAGGGAAGTCGACCAACATGACGGACCACAGACATAGCTAGCG
TAGCGAGCATTCAGACCTGAGTGACGAACAAGTTGTTCTTTGATTGCTTCCGAGTGAAAGATATTCCGGTGGTCCAGACCTGATGGCTGTTAGAACCCGA
GACGAACCTTGCTGATGGGAGCAGCTACACGCACTCCAGAGCcattgctgccgctgctccgaTACGAGCCGTTGCTACCGACACTGCGCACAGACCGATC
GCTGCTCATTTGCAAACACACATACACACACCATCGCGTTAGTTGATCCCAGTCTCAAGACTCGCAACTGCAACATGCAAAGCAAACCTTTTGTCACTGC
GCGAAGACATGGGGCGTGGCAGGCCTCCACCGTCGgccctcgctgctgccgttcgtcCGGGCGGCACCGCCGGAATGTGCATCCCAGCCTCGCGCACAGC
CATCTGCATCGGGTCTCCAATCTCGGGGAACTCGTTGGCCAGCTGACCCAGCGTGTAGAGCAAGCTCGCGCtgatctccttgagctccagcgcctccagc
atcACCTGCTCCTTCGTACGCCAGCTAGCGTCGTCGTTGAATCCGCCGGCACTTACAGCGAACTGGCGGTGCTCCCGCATCTGCCGCTCAAGCTTCTTCA
CAACCTTACCCCACTTGGCTCGCTCCGTCTGCACCTCGCGCTCCACTTGTGACAACGCACCCTCGAGCTGCGTTGCGTTGGCTCGAGCGAAATCGTGCTG
GGTCTCCACTTCACGAAGACGCTGGGTCTCGCtcgtcacgtccagctcaACTCGCGCCaactccttcttcttcttgaagaacgCGTCTTCCGCCATCTTG
GCCTGGGCctcaagagcagcaagacgtTGCGCGTCGTCACCAGCGAGATCGGCGCGGTGGAAGCTCTTGCGGTAGGCCGAGTTGCGCTCTTCCAGGTGAG
CCAAAGTCTTCTTCAAGGCGCGGACATCCTTCTCGGCGACGCGGATTTTGTCATCTAGCTCGTCCCCCtcacgctggagctcctcacgacgctgagctgc
tcgaatTACGAAGTAAGCTTGGCTGCGCTCCTTGCCTGCCTCAcctgcatcgtcgtcgtcgtctgcgtaGGCACCCATCTTGCAGAGCGTCTCGAACTTG
GCCTGTAGCTTACGCACCCGGTTCTCTCTGTCCGCAAGCTCAACGGACACGCGATGACGTTCGTCTTCAATGACCTTGTTGGCAGCACGCTGCAGTTCTT
GGTGCGCTGCAatctcgcgcttgcgctctTCCATActct