Description :
From Genome Similarity Track
Location :
Scaffold_51:143559- 145132
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013468Similar to SYP41: Syntaxin-41 (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G013467candidate b-glycosidase

Sequence
1573 bases(100 bases per row)
GACGACGTCGACCCACACAGGCGCGACGTCCACGCGCGTCAAGTGGTCGCCGTTCTTCATGAGCGCATTCTTGGCCTCCTCCGAGGGCCCCACGATGTTC
CGGCGCCGGAGGCTCTTGGCCTTCGCATCGGACCGGAGCTGCAGGAACGTCCGCGTCAGCTCGCGCGTCGCCATGTCGTTCCGCCTGCTACGCTTGCGTC
TGCTGTTGTCTTAGCGGTCGGTATCGAGGCGCGCGTGCTGCCGCTCTCTCGCTATTTTCCTGCAACGCAAGGACGGAAGGAGCAGCGAGGGGGGAATTCG
GCTCGTTATTTTAAGCACGTTTGTCGCCTATTGTTAATGCTCGCGGCGTCGTTCCTTTCCTCACGCCCTCATGCCACGCAGAAAAAACAGGGCGACTTCA
CCTACGTATCACCCGGGTTCATACGTCCATCTTTTGGTGAAAACGGGTTGAACCCGCCGGCCCATCAACCGGAGAATCAAAATAACCTTAAACTTAGTGA
CCAAGTTTTTTCATTGGCAAAGACCATCACTCTGCTGGGTGAGCACCGGTATCTCTTGGAAATCATACCGGTATATATCGGTATTTGCTGCTCAAAATGG
TTGCGCTAAGGCGAAAGTGAAGGGCAGGAGTTGAAGTTGAAATTTTTGGTGTGGAATGCGCCTATTACAGGGCCCGCATTCCCACCACACGAGTGGTGCC
CCCCATAGCGTAACAGGACCGCGCGCACAAGAGAGCTCTAACAGCCCATAAGATGGCAACGAACGTGCTGCTTCCACTGTTGCTGCTAGCGTGGAGCAGC
GCCTTCGGCGCCGCGCAGAAGCTGCCGCTGACGACGTGGCGCTTCCAATCGCACAATGGCTCCATCCGCATCGAGAACGCCAGCGTCCCCGGTACGTCAC
ACATGCACCTGCAGGACGCGGGTCTGATTCAAGACCCGTATTTGCGGTTCAACGAGCGCGAATACCAGTGGGTCGCCAAAGAAACGTGGGTCTATGAGAC
GCAGTTTACCGTGAGCGACGGTGATGCACTGCAGAACAGTAAACTGGTGTTTGAGACGCTCGATGGCATCGCGCATGTCTTCGTGAATGACAAACATGTT
GCCTGGACCGTTGATTCGTTCATGTCGTATGCGTTTCAAGTGGAAAGGCTGCTGGTGCGGGGCACGAATGCCGTAAAAGTAAAGTTCGTGCCTCCACTTG
ACTATGCACTTATCCAGGTACGGATTGCTTGTGTGATGGAGAAGATATCTTCCGCATGCTTATCGATGATTATTGCGATTTCTTATGTATTTGTAGTCGG
AACATTACCCGTACTTTGTCCCTGCGACGCAAAACTTCAACACGTGGGCTGAGCCAACTCACCGGTCGTTTATCAGGAAAGCGGGCTCGGACTTTGGATG
GGATTGGGGTCCGGCATTCGCTACATCGGGTATCGCTGGCAATGTGTATCTCGAGTTTGGGGCGTCTGCGCCGGAACTGAAGAACTTGAACGTGATTCAA
GAGTTTCCACAGGGAGAGCACAATCTCTCAGTCGTGCAATTGACTATCCAGGTTTCAGTTGACGGGAAAGGGT