Description :
From Genome Similarity Track
Location :
contig_18:143552- 144963
Transcript NameFunction/comments
g4384.t1hypothetical protein

Sequence
1411 bases(100 bases per row)
CGTGGTATCAACCTTAGTGGCGGGCAGAAGGCCCGCGTTAGTGTGGCGCGAGCCATGTATCGCGCCCGGAAGTTTGATTTTGTAGTTCTGGATGACCCTC
TGAGCGCGTTGGACGTTCACGTGGCCAATGCCGTGTTTTCAGAGGGCCTCGCAGGCCTCGCGCAGGGGAAGACACGCCTCCTTGTGCTGAATTCGCACTA
TCACTTACTGCAGTACGCAGATCGTGTGTTGGTGATGGCGGACGGACAAATTGTGGGCGATGGCACATTACTGGAGCTGGAACGGGAGTTTCCCTTTTTA
GTGACGCCTAACATTGAGAACGACAACGACGGAGATTCAAAGGGTGTGGATGAAGATGCCCATGCGCTCGAGCGAAAATCGTCGCTTGCAGTTGTTTCTT
CCAAAGCTGATGCCGACGGAAACGGGAACCTAGAGACAAGGGGCAAGCTGATTGTTGCAGAGGATCGGCTGGTGGGGGCTGTGAAGATGAAAACGTATAT
CGACTACTTGGCTTCGTCCGGGTGGAATGGCTACTTCCTTGCCTCGGTGGTCTTCACTCTCTTTGCCGTGGCCCAAGTGGCGCTGTTCTTTTGCGATTGG
TTCTTGAGCCAATGGTCCAAGGGCAGCTTTGATCTTGCGTCAAAGAGTTCGTTAGCGATTTACGCTGGACTTGTGGTTGGCTCAGCAATCCTGGTGTTCA
TTCGCTGCACGTATTTCATGCGAGTGTGCATGGTCTGCTCAGGAATGCTGCACTCCAAGTATCTTCTGAAGGTCCTGCTCGCCCCAGTCACTACCTTCTT
TGATGTTACACCTGTGGGTCGCATCCTCAATCGATTCTCGCGGGACCTCGACCAAGTCGACAACCCACTTCCATACTGGGCCTTGTGGATGCTGTTGATG
ATGTTTCAGATGGCTTCAGCATTCATCGTCTGTGCTGCGGCCGACCCGTACGTGTTGATCATCTACGCTCCAGTTGGCTTGGCGTTTGTCTTTGCGATTA
AGGTGTATCAAGCGTCCGCACGAGAGCTCAAGCGCTTTGATAGCATAACGCGCTCGCCGTTCTTGAACCTGGTTTCCGAAACGTTGTCGGGTATTGAGAC
GATCCGATCGTACAAAATGACCGAGAAGTTTTCAGCTCTCTGTGAGCAGCTCCTGGACCAGAATTCGAAGTACTACCTGCTTTACCAAACATCGTCGAGG
TGGTTCGCCATGCGAACCGATTGGCTTGTGTCTGTGATTATTGCGGCGGTAGCAATTCTAGCAATTGCTACGAAATCAACGCTTGGAGCTTCGGTAGCTG
GGCTGGGTCTCACCTACGCAGCTCAACTTACGTCCAGTTTCCAGCGAATGACCACCCTCACAACCCAGGTTGAGCAAATCATGACCTGCTTCGAGCGCAT
CGCGCACTACG