Description :
From Genome Similarity Track
Location :
contig_86:143546- 148613
Transcript NameFunction/comments
g10489.t1hypothetical protein
g10490.t1hypothetical protein PHYSODRAFT_254957

Sequence
5067 bases(100 bases per row)
CGTACAGAACAAGAAGGTGTTTTGCGAGTGCATGGAGTGGAAGCGCAAAGAGATAGAGAAGAAGTGGAGAGAGCACGAGGATATGGCACCTGCTGTGGAC
TGACAGCACCACACGTAGCGTATCGTATCACGAAATACATTGTGCATGTAGTGCCTTAGGGGAAGAAACGCAGCGCCAAGGTATCGTACAATCAAGAGCG
CTGCACTATTTGGGTTTGCAAGCCAGCACACCTCGGCATGATAGCATTGCGGGTGAGTTTATTCGCTGATCTTTCGGGTTCAAATCCTGCGTTTTTCGCC
TTGAAGTTGTCCTGATAATGGCTCATGTCCGTTTACCAGGGCAGCTCGGGACCTTGGAAGTCGTAGAACTTGGCGGTGTCCTGGAGCGCGACGCCGGAGA
GGACCTTGGTCATACCGGCGATGGAGTCCTCGGGCTCCACGGCGCCGTGGCCATGGTTCAGGTCGGTCTTGACGAAGCCGGGCTGCAGCACGATCTTGAA
CGGCGAGAGCGCCTTGAGCTAAAACAACGAGGAAAGAGGAGTTGGGTTAGTAAAGCAAAGAGTTCTCCAGTGCAGAGGGTGAGTCCGTACATCGTGAGGC
TACGCTGAAAAAAGTCTTCAATCGAGCGTCTTAGTGCATGCTTCCACAGACACCGACATCCAATTTGTTGGTATAAAGTCCAGGACCTGGTACGACGACA
ACGAAGCATTGCCTCGCTGTATCCAAGAGAATGGGCCGGAATTTTTTTTTGTGCTTCTAGAAGAAGAGTTTGTGTAAGTGTTGAATTCGTTGGTTCACTA
CAGTGAGGTGTACAACAACTAAGAGAAAGTAAATGGTCCATTACATTGTTCAGATACGAGCGATTGACTTTGCTGTTTTTACTGCTGAAGTCCCCAGACA
TAGTTCGCGAACGACATGTGGCCGATTGCCCAGCCACCGAAGAGCCCCTTAGCTCCAGGTTCTTTTTCGTCCATGCCCGCTCCAGCAGCGACAACAAACG
GCATGAAGTGGTCGGGCGTTGGGTGACGAACCTCACTCCAGGAGCATCCCGCCAGTTCGTGATCTGCTTCGTGCGCTCAGAGAGAATCAGCTTGGACTCG
GAGGCCATCGTGCTGTCCAAGCTTTGAAAAGTTCTCGCTTCCCTCCACGAGAGCAGAGCTAGAGCTACGGAGACCGCGGAGGTTATGCGTCGACTGCCCC
GAGCAAATGATCAGCGTGTCTTCGTCACGAAAAGGTGCCAGCGCCTGGCCCAGGCCGAAGTGAGTCTGGTTATCCAAGTACGAGTTGATGGACATGGTGA
CGATCGGGATGTCAGCCTGGGGGCGGATAAACCTCAAAGGCACGAAGACTCCGTGGTCGAAACCTCGGTTCACGAGTTTGGCCTTGATGTCGTTCTTCTC
GAGCTGATCCTTGACCTTCTGGGCGAAAGCAGGGTCCCCCTTGGCGGGGTAGACCACCTCGTAGGCCTCGTCGGGGAACCCGTAGTAGTCGTAGATCATG
TCGGGTTTGGTGGCGTTGGAGATCTCGAAGCCGCTACTGTCCGACTCGAAGTGCGCCGACACGAACAGGATTCGCTTGGGCAGGTTCTCGCCCTTGGGGT
ACAGCTTCTCGAACAGACCCGAGAGCAGCTCTACCGCCGCCGCAGAGTCTCGCTTCACATTGTTGAAGTCGGAGGAGAGCAACCACAGCGGACCAGGTCC
GTGCGAAACGGCGACTGTGGGGTGGCGGAAGGGGGCATCGTGGAGACTGGGCGGACTTATTGGGTGGAAGCAAATTGCTCAATGAGACTGCATGGAGGGC
ATCAACTCAGCATGTGAAGCGATAGCGAGACAAACCACCAGGATGGAGGAAGTTCTTGAGTAGTAGAGCTGCAGACTTTGACGAAATGAAAGAATATTTT
TAAAAAAATCTGTTCTCAAAAGACTGCATTACAGTTATAAAGTCTGACGAGTCAAATATCCTAAAAGATGGCGTAATCTGGCTTAAAAAAAAAATGGACA
CGTCAACCGCGAAAAGGGGAGGTTAGGTGTACAAAAATGGCGGGAATTGGGTGAGGAGTAGCCAATGATCTGGCGTAATCGGTGATATTACATTTTACAG
CTCGCAAAAGAAGGGAAATTCGAATTCTACACTTTTCTGCTGGCACTGCCAGTCAACGAACTACCATGGGACCAAAATATATCCGACCTCCGACCTTTCC
GACCATGTATAGAAAATAGTATGCAATACAAAAGTTGAGTGACCCTGTAAAAATATTCGTAAAAAGGTAAATACGTGTTTTGAAATGATGGCACTGAGCC
CACGTGCCCTGCGCAAATCCGTCGACGCGTGTCAGTGCCCGAGTGACCATCCTGGAGGATGAATTGAGGGAGGTGTGCCGAGCATCGGTGCACTGAAGAG
GGTTGTCGCTGCCACGAAGAACTGTGGTTGGTTAATGCTCCCTCGGGCACTCCAACGAGTATACCCTGCGCTGAGTTGTACTAACCCCACCTTAGTAGCT
CAGTGGTAGAGCCCCCGAAAGGGATGGTCGTTGGGTCCGATTCCCACCTAAGGTATTTCTAATGTTCGACAGCATATTGGCCGGTGCAAGGCAGCGAGTG
CGAGCCTATGTGTGGAAGTATGTGTCGATGTGTGACAGTACATGTGTTGCGTTGTGAAGCAGTGTGTGTGTGTGTGAACTAACGTGTATTATGCAATTTA
AAGTGCTGGCATATTTACGCACGAATCTGTTCCAATATGTTCTGCGTGTAACCAGGGGCAGGGTCTTGGATGGCAGGTGTCTGGAGAAGCTGTTCGTGGC
GCCCAATATTTGTGTTGAGTGTTCCAGCACGATGGAGTATGCGTAGGTGCTTGAGGACGGCTCCGGATCCACGGGAGCTGATGTTGTGCTCACCAAGGAA
CGCGAGAACAGACTCCTCCGCGCGAGCTCCGAGCGACAGTACCTGATCGCGATAGTTCGGTGCAGTTGGATCAAGCACAAAGCCGTCCTCCAAGAAAAGC
TTCATGTACGCGACAAGTTGCTTGGCATCGGACTTCTGCTGCTTCGAGATCGGTGCCCGCCACATCCGTGGTTCATGAGCGTACCACGCGTACCAGGTCG
CGCGAAGGTGAGTCACTGCTGATCTGCGCTGTTTCTTCTTGACGTTACTGATGTCGCTTGTGTCGGTGTCTGGCTTGTGTCGTTTGCGTGTAGCATGGCT
AGGATTGTTGTTTAGCTTAGCCTCGAGGGCATCCATGCGAGCATCTTGCCGCTTGACGTGCTGGATAAAATGATTAATGACAGCCGCTTGGTGGTCGATG
ATCTTCTGTTCTGCGCTTGGCTCCATCAGCTGCTTGGATACCACGATCTGCTGTTGCTGGTGTGTGCTTTGTGACTTGGTGTCTTCACAGGTTAGCTGTG
GCTTGCAAGATGCGACGACCACGCCAGTAACTCAGAGAGCGAGCAGCCGGTGTCAGCTACACAGCCTTCAATGCGCTTGACAGCAGGTGCTTCAGCGTTC
AAGTCTTTCAACAGCAGATAGTGCCGAAGCACACTCGAGGTAAGCACATCCAGAACTGCTTGATTCACGTTGTGTCGTGTGGTTTCGAGATGGTGACAGG
TCGTGAACAGACGGCGCTGGAAGCTAGCGACCATCGCCCTAGTTTGTGTGTCGAACGTTGTCAAGTTTTGGAGCGACACCTTTGCCTCAGCGCTATGTCC
ACTGAGTATCTTGCTAACCTTGTGATATTCCTTGCTGGTAGTTGAGCCCCTTGTTTGTTGTGCTCATATTCCAGGCACCTCTGTCGAAAATCCACCGCGC
CGTGAGCTCCCCGCTCCCATTGGCATGCTGTGCACCGCCGCGTCTGAAGGAATGAGACGTCAGCGCAACCTTGACTCCTGCGGCTGCAGCAATTCGGTTC
AGCAACCGGTTCACGTGGGAGTAGATGGTGGGCGTCGTCTCCGCCCCAGCAGTCGACGGTGCATCAAGACCTGTGGTGTCTGTAGGATGATTGAGGATCT
CGAGCAGCGGGACATCTGGGGAAAGCGAGATCGCGGCTTGGCCAGGCAGCTCCGGCAGGTTGTCGATGACGTCGGGAGATGGAGCGGTCTGCATCATCAG
GGCCAATGCTATCGCGAGCATTGGGCACGTCGTGAAGTCCGTTCCGGGGAAAGCGACAAGCCCTGCTCTTCGGATGTCTTCATGCGAATGAAGCGCACGA
AGAGCACATTTCCAGCGTCGATGGAGACATTGGGCTTGCGGAGGAGCGCGAGATCTGAAGCTCGCCCGAACAGGTGCCACAGCAGACACAGTAGCGCAGC
ATCTTGGTAGTCACTAGAGCAGCTTGCATGAACATACAAGTACGCCAGCATTCGTTTCAAGTCAGCCTTTGTACATGGTGGTGCCTTGCTAATGAAGCCA
CCGCCGTCACGTTTCATACAAAAATTGTCTAGAGTCTTCCCCATTTTGAGCAACCGTGCTTCCAGTGCAGCTCGGTGCTGTGGAAACTGATCCAACAGCC
AAAGTTTAGCTTGCCGATAGTACTGCATCGAAGTGTTCCGTGATAGTGGCTTGCCTTTCTTACCCTCTATGAATGCAAGATGCATACCAAACTTGTCCAT
TACGGACACAAAGCACTTCCCACTCTCGTCACGCTCAATACACACACGTACATACTCCTCTGTCACACCCTCAGACTTTAAAAATCTCATGAATGCTGAC
ACGGCAGTTGCCTTGGCACGCTTCGTGTTTCCAGGGCTAGCTCCTCCAAACCCATCCTGCAGGTCGGATCGATGGCAAATATGCGAGTGATATGCTTTTG
ACTTGCCTTTTGAGAGACGATACACATATTTGGCGACTGTTTCCGACGGAACGGCTGGCCTACAGGACTTGCCTTATACGTGTCATGCTATTGGCCAAAA
TACGGGATCTAATATACAATGATTGGTTTAAATTGTACACCTTGGCTCCCATTGGCCTTTATGCTCAATACAAACTCAAAGTACAGTCGGATAGATTGTC
ATATTCAACCATACGTTTGACACGCGAAGCTCGGATACTTTGCCGGATTTTAGTCCTGAAAGTGCAC