Description :
From Genome Similarity Track
Location :
contig_30:143535- 145202
Sequence
1667 bases(100 bases per row)
CAATGCTTTTGTATCTTTAAGGCGCTCAAATTCTGTTGTGGCGAAGACGTTCGTGTGCCACTTTTTGTCGACGTTGGGAAATCCCCCAGCTTCGCTGAAT
TTTGAGAGAGCTTTCGTACTGTTCCTGGCGTATACGATCCCTTTCCAGCTCTTCTTGTTGTTCATGGTGCCACTTGAGCCACAATGTCTGGATCTTGAGC
GCACTCATGTGCTGCTCGTGCTGAATAAGCTCTCGCTCCATTTTGCGGCGGTGTTGTCGATTTCCCCAGTTTCGTTGGATTTTCAATGAACTCGCATTCT
GCGTTTGTACCAGATATTCCTGCTGAAGTTGTTCGTCTTTGTGATGCTCCAACTCAGTGTTCCTCTCCATGCTTCGTCGCTGCCACCATCGATAACACGC
ACGTTGTATCCTCGCCGAACTTAGCTGCAGGTTTTCCTTACACTGCCACTTTCGCCAATTCCGTTGGATCAGTGTGATTGACAGCATTTGTACGCGCTTA
ACTTCCTTCTTCTCCTTTTGCCACTTGTCCCAATGTTTTTGAATTCGCTTCGCACTAAGGTCTCGTCTTATTGTCAGCTCGCGCCATTGACGCCAACATT
TTTGGATCTTTCTCGCACTAGCCTGTCTTTGAATTCGAAGCCGTTTATTTTCCTCCTCAGCTCGTTGCCACTGCTGCCATCGCAGCCACCTCCTTTGTAT
CATTTGGGCACTAGCTTCGCGCAAAATTCGGATTCGTTCAGCTTTGGCTCGCTGCTGTTGCTGCCGCTTCCGCCACCACCTCTGTATACGAAGCACACTG
GAAAACACAACGCGTTGAACTTCTCTTTCCTCTTGCTTGCGTTCGACCCATCGTCTCCACACAGCCTGAACTTTGCGCACGTTTGCTCGAACTCGTATCG
CTGCCAAATGGCATCGAACGTTTGTTGGTGGTGGTATCTTCGATCTCGCTCGCGCTTGACCCACCGTCGCCAGGCACTCTGAATCTTGCACACATTCGCT
CGAGTACGAATAGTCTCCAGACGCGCGTTGAAAACCCGTCGTTGTTCATTTCTTCGTTCACGATCGCGGATGACCCATCGTCTCCAGACAGCTTGTATTT
TTCGGACGTTGGCACGAGTGCGTAGAGCTTCAAGGTGCATATCGAACGCAAGCTGTTGGGCACACTTTTGTTCTCGCTCACGTATGACCCAACGCCTCCA
AACACCTTGAATTTTACGGACGTTTGCTCGAGCTCGGATGGCTTCCAGGCGTGCATCAAACAAAACTTGTTGCTGGTGCCTTCGTTCTCTCTCGCGTACA
ACCCACCTTCTCCACGCACCTTGAATTTTGCGGACACTTGCTCGTGCTCGGATAGTTTCCAAATGCATTTTGAAAGCTTGTTGCTGTTGATTTCTTCGTT
CGCGTTCGCGTATAACCCCCCGTTTCCATACTCCTTGGATTTTGCGAGCATTGGCCCGCATTCGAATCGCTCTCAGATGCGCGTTGAAAGCGAGTTGCCT
ACGTTCTCGTTCGCGAGTGATCCAGCGCCTCCACACACTTTGAATTTTCCTTACGTTAGCTTGAACTCGAATGGACTCCAGGCGTGCATTAAACAACAGC
TGCTGTTCACGTCTTCGTTCCGCTCGCGTATAACCCAGCGCCTCCACACGCATTGAATTCTACGAGC