Description :
From Genome Similarity Track
Location :
Scaffold_248:14353- 21001
Transcript NameFunction/comments
Phymu_g7491hypothetical protein PHYSODRAFT_301786
Phymu_g7492hypothetical protein
Phymu_g7493hypothetical protein
Phymu_g7494hypothetical protein PHYSODRAFT_315622

Sequence
6648 bases(100 bases per row)
caagagACCGAGAAGATGCACGCGACGGTCTCGATCTCAGTGAGGATTTCCTCATGGGCGGACGAGGTGACGACTTGAAACGGAGGATGACACAGCGTGA
CTCTGCTCGGCGTcggaagctggaagagcaggaggagaaactTGCAGGACTCAAGGTACAGGGTTTGAGGTTTCAATAGCGTCTTGTAGGCTGCTCACGT
TGTATCTACTGACACTAGGCGAAGGAGAGTGCGCGAATGGACAAGTTTCTGGAGGAAATGGGTCTCTCGGGACCCAACGCTAACGGCGGCAAACCCATGA
GGATCGCTCCACGCCGATAAACGACTGGCTCTATTGTAGTGGCTGAAGGAACGTGGATGGGCCGTTATTCCAGCTAACAtgccttctcttcgtcaGTGTT
GTGTTGTTTTTCCTGCAGGGGTCGGTAATCATTCGTGTCGATTATTTTTCTGGCAATCTTTTAGGGAAGATTATGGTGTGGGGAAAGGCTTCTTCGTTGT
CTACTCACCATTAAAATACGTAGCCCATCGCCAGGATATTCCGGTATGAAGTTGTCGTCTCGACTTCATTGTGCAAGTTTCGCTGCCAGCCAGTCATGGG
TGCGAGCTCCATTTGGCTACTAGCGGCGGTCGTCCTGTTTGTTCATATCGAAGCTTTCTCAGCGCCAACAGACTCGTCCACGAGGTTCCTACGGACGCAA
GTGGATAGTGAAGACCCACATGAAGAGAGAGCGGGACTTCCAGTGTCCATCATTGAAAAGGCCAAGACTGCTCTTCGACCGAACGTTTCCCCGGGGAAGC
TCGCGAACTGGTTAAACAAGGGGAAATCTGTtgacgacgtcttcgcgaggctgcagctgaacAAAGCGGGGGATCAAATCCTGGACAATCCTCAGTTTGC
CATTTGGTTGTCGTACGTGGACGATTTCGCCAAGAAGAATCCAGACACGGAGACGTCCGCTATCTCGACTTTAACTAAACATTTcggtgctgaagctctg
aCTACGATGGtccaagcagcgaagaaagTGGACGGGACGGAGGCTATTGCCACCAAATTGGAAGCTTCTCAGATGCTAGCGTGGCTGTCCAGTGGGAAAT
CCGCCGATGATGTGTTCGCCATTCTAAGACTTGATAAAGCGGATGATTCCCTGCTGATTAGCGCCATGTTCGACGTCTGGAACAAGTACCGGAAGATCTT
TGACCAAGAAAACCCTACGAAGGCCAGGAGTTTGTATTCCACTCTGACGAGGCACTACAGAGACAGAGACGACGTCCTGGCTGGGATCATCCAAAGTGCA
AAGGAGAACGGAGCCACAAGAGCGGAAGCTGTTCAGTTGGAAACAGAACAATTTCGGGGTTGGACAGCATCCAGGAAGACTCCAGACGACGTTTTCTCTC
TTCTCAATCTTCAAAATGCAGGAGATAATGTCCTCACAAGCTCTCAGTTCGCGTATTGGAATTCGTACGTAAGACTTTTCAACAAGGAGCAACACGAGAG
AGCGAGTGTTTTCTCCATACTGATGTCTAGATACGGAGACCGCGGGATCTCGAGggttgtcgaagctgctctgaAGGCaaagagctcgtccacgGTGGCT
AAAAGGCTCCAAGCCGAGCAATTTCAGCGTTGGATGGCCAGTGGCAAGTCGGCCGATGACGTCTTCGCGATGTTAAGACTAGACCGGGAGGGCGAGAAAC
TGCTTGATAGTCCTCTGTTGAGCACGTTCACCAAGTTCAGCGACACGTTCAACAAGCAGAATCCCGACAAGCAGACCACAGTGATCTCTGTATTGACCAA
GTATTATGGAGATGAAGGGATCGCGAAGATTCTCGGACGTGTCCCGGGGCTGTCCAAGCTCTCGACGGActtggagatggcgctgTTGCGACACTGGCTG
AGTGGTAAGATGGACCCACGGGACGTTTTCAAGACGCTTCGGCTGGACAAAGCAGGGGATTCTCTTCTGTCTAGCCCCCTCTTCACCATGTTCACGAAAT
TTACGGACTTCTACCACGCTAAAAACCCGAGTGAAGTCTTGAATACGTACGCGATCGTACGAGCTCATTACGGCGATGATCAAGTGGCCAGAATGATCAT
GAGAgcggagacgaagctgagTTCTTCGGGGGCTGCAAAACGGATGGAAGCTGTGCTGTTCCACGAGTGGATGAGCTCTCCGGATGGCGCTTTTAGAGCT
CTGAGGCTGGACCGACCGGCTACTCTTCGTCCGgacatgaagctgcttgacgaTCCAGTGTTCAACTTTTGGGTGAGGTTCCTGGATGATCTCAACGAGG
TTTTCCCTGGGATGACGATGCCGCGGACGCTGTGGGCCAAGACCTACACAAGTAAAGACATTGTGAAACTGGTGGcaaacgccaagaagagtcCGAACAC
GCGCGCGTTGGGCAGAAAGTTGGAGGCGGAGATGCTCCGAGAGTTCGTGTTCGACGGCAAAAAGCCAGAATTTGtcgccaagctgctgagtgtgaagaag
aagagcgattcgaactggaagctgtggGAGAAGTACGCGCAAGAGTACAGCAAGTATTAATACTATCACCTAGGCAGTGTCACGTCCGTGTAGCTCAAGA
TCCAGACTAGGACGAAGCAACGGAGCTCGGAAGTCTTAAAAATAAAAGAAGAAACAAAATAATATTAGGACGATGTTAAGAgtccccaacaaaagcaact
tctcagcaactttacagcaactttacagcaactgaagctcctgtCGCACGATTCTACACCCGAACCCTAAACCCGAACCCTAAACCTGCCAACCCCTgga
ttgagcagtaaatgtcacgacttagcacaccgcgcgaaggcttcgcttcgcacgtcgatgctaactcgttcttgttaGTCCGGGAGGTTTGACCCTATta
gtcttgcagcgctgcgcttggactcgcGTGCCGAAGTcaggcgactttggcgattagGTGATACTTTTCCCTTTTCTAaaatctcgttggggacgctagt
cacttccAATATTTAAAAATATCAATCTTGCATTTTTAAGCCAATAACTTACCTGGAGTAAGAGCAACTGTTAGCTGTGTTAACTTAACTTAACACAGAC
AGATTTTATTCTGAGATGGTGATCCTGAGTCAGAATTTCTGACCGTAAAGTATACATAGACCGGTTTTGAAGAGCCTGTATAGGCTTTGTCTAATGCTTG
TAGGCCTTGCAtctgaaggccaagaagggcTTGCGTCTCGAATTCTTCCGCGTCTCTTGGAGTCTTGGGGGGGGAACGATAAAGCTCCCAAATTGCATGC
CACTGGAGTGAGAGCTTGATCAGCTTTGCCGCAACTGATGCTTGTTTCAGGGAAGTTGTTGTCCACACTCACGCGTTAAATCCACATTAGAGATCCTTTC
GTGTTGGGCGGTGAGCTGGAGGAGTGGTCCACTGGTATTAATAATAAGTACCGTAGACCGCATCAATGTTGGCGAGACGGTTCGTGGCATTTTTCCCCCT
GGTTACCGTTTCTAGCCACTGTTCGAAGAAAACGAGTCCAAATATCGCTGCTGTCATGCATTTACTTGCAGGATAAGCACACCTCGATCTTTATTGTGTG
CCGACTTCTATCTGAAGAGTACGACCTCTAGAAGTGGACGATGAAATTTGTTTTCGAAGTCGGTCCTCTGTGAAGCCGCAGTTTCTCCAAACCTTGAACT
TGCACTTGCACCCACCATTAGCTTTGTAGCCATCTCCCGGTTGCTAACACGTAAACTACCGTTGAGTCTAACAAGCGCGGTATTATTCTCGGTTTTGCCA
CCATCTTGTATCATGGGATCGATCCAGTTTTCCACTTTAATAAGGGACTTTATATAAATTTCGCTGGTGTACCAACGCGGATCTGTTTCCCAATCAACAT
GTGGTAAAAATCCCCATCGCAGTTTAATCCCGTTCACGCGTGATGTGGCATTAGTGATCCACTGGATGATCCCTTGTCAGAGTGAATGAGGGCGACACAA
TGCCCTGTAATACCGGCGTACTCcctcacttttcaattcTATTAGGTAGACACCAACCGTCAGTTCCTCATGCGCGTTCACTGCCTTGTGCTtttggctg
ctgctatcgTTTCTGCCactgacgcagcagcagcgcgatcCCTCCCAGAAGCGCAGACTTTCTCGAGGTTTCTCAGGACCCACAAGGCGTCGAAGACCGC
CCAGGACAACAGCGAAGAGCGTGTCAATTTCGCTGGCATCGAGCTTAAAATCGGCTTCCTTGACGATGTGATTGAGAAGATAAACATGAGTCCGACGTTC
AAGGAGCTTTTGGCCAATAAAGGGAACGCCGAGAAGGCGTACAAGGCGttcaaggtggacgacgtggccgacGACGTGTTCCAGAGTTTGCAGTGGAAAG
AGTGGGCGGACTACGTGAAATACGTCGCTGTCCGTAACAACGAAAACGCCGACGAAGCGCTGGCCGCAGCCATGTCGGTGGCCTACAAGCCCGACGGTTT
GTCCAAGATGCTGGCCACCGCAGCCCAGAACTCGAATACGAAGGAAATCGCCACGGTGATCGAGAAAGCGCAGCAGAGTCGCTGGATCCGCGGAGGTTTC
ACCCCCAACGCGATTTTCAAGACCCTGAAGCTGGATAAAGCGGATGATATCTTCGACACGCCCCAGTTCGCCACTTGGACCAATTTCCTTAAGGCATACA
ACGACAAGAAcccgaagaaggcgatgacggAGTTCGAGGCGCTTTCATTCACTTACGAGGAGCAAAAGTTTGTCAAACTGCTGGCATCGGCTGATGACGG
GCAATACGCCCAAgggctcaagaaggagctaGTGCAGAGTTGGATAGACGACGCCACGCACCCGATCAACATGTTCGCCAGACTGAAGCTTAACGAGGGC
GACGATATGCTCACGAATCCGGTACTGAGTCTGTGGGTGCAGTACATGAAAGCTTTCAACGAACAATACCCCAAGCaggcgacgacgatgatcgGGACGT
TCACTAAGACTTACGgggacgagaagctcgcgctTATGATCCGGGAGGCGACAAAGTCCAGTGACGACAAGGTGGTGGAGTTTGCCACCAATTTGCAGAC
TGCGCAGTTCAACCAGTGGatggtggacaagaagagccCGAAAGAGATGCTCACGGTCTTGGGGATCAACTCGCAGACGTTGAGCGAGAACCCTCTGGGC
AGCGTCTGGAGAGCGTACAACAAGGAATACACCAAGAAGATGGCAGACGGAGACTTTGCCTTCCAACCGTAAGTTTTgtaactacatgtagtaacaacaa
caaaataGATTTCCAAAACTGTTTTACATGAATTTCTATGTACAAAACCGTCCTACACCGCCGTTGCAGCCCACACATGTCGTCTATCGCTCTCTTCTGA
TGCATCTCGAGGCTCTTCCCACCGTTCCCAATTCAATTCGAATCCAAGTTTCAAAGAATTCACTGCCGCTCGCAGCTTCACGACGATGACAGTACTCGCC
TTCACTCCAAAGCGCTTCACCAGAGCGTCGCTATCTGACGGCAGCTGCATCACACGGTCCATCACGAACTCAAGCATAGACTGgaaacgagaagctgccg
cgTCATCGAGAGGAACTTGTCCGATAGAGAGCACGACCGTTCCCAGTAGGACCAAGAAGTGGGTGGTAAACTCCAGAAAAACCGATTCCACAGTCTCTAG
GCGCTTTTCCTTCATGGAAAGCAATTCGCAAGAAGCAAAGACACCCAGTGATGACTCCAGAGCCTTGAGAGTCGATGAGGTCACACGCCAGACGAGAtcc
cacagcagcaacgttgaAAGTCGTAACGGAGACGTATCACGAGTTAAATCACCCGCTGCCACCGCCTCGTTGAATGATCTCGTGAAATCCAACAAATCAC
GCGACAGTGCTGCAACCTGCGCTTCCCACTCCACAAGACTTCGGGTCTTCTGTCCTTTGCTTGCACCCTTCGCGATCCCAGCACTCAGGCGCCTCAGTTC
TCTGTAGCGTTGCTCTTCGAGGTTTATCTGCGGCTCCTCTGTGGCCTGGggagcgacagcagcacttgcaacCTTCGAAGCAGAGCCAAGATCCTTCAGA
AGACTCTTGTTCCGGAAAGCGACACGCTTCACAAACTCGGTCTGGGAACTCTTCGGGATCAGAGTTTTTAGTGCGCTGCGTGTACGTTGAAGCGCAACGG
AGACGATCGAATTGGTCAGTGTCGAGTGCGACGACGGGGGCAGGAacggaggaactgctgcactCACACGCTCTTCTCCCAGTTGAAGGGCTTCCTGTAA
AGCTACTGCGACGGTGGAGTTCGCCTCGTGGTGGGTCTTGGAGGTTAAAAGCACCTGGAACGATGCGCGGGCGGCAAatgcagcgtcttggcctAGAGCT
GAACTTGAGGTCAGTCCGCACTCCGATGCACACCGTCCAACAAGAAGGTCAGCCCGCGGAGAGACTACGTGAGATATGACGTGCTCACACACGTCTGTCG
TCACGGTTCCAACCACGAActccaccaccgccttcAACTTGGGATGCACCTTGAACACAGCTTCGGACAGTttgtcgttctcctcctgtAGTGGCGGAAA
GTTGAAGGGGGAACCGGCGGATGCTTTTACTCCTGAACTGGCACCGGG