Description :
From Genome Similarity Track
Location :
Scaffold_59:14352- 18914
Transcript NameFunction/comments
Phyag_g1364conserved hypothetical protein
Phyag_g1365hypothetical protein PHYSODRAFT_354946
Phyag_g1366hypothetical protein

Sequence
4562 bases(100 bases per row)
CATAGGaaactgctgcttgagcatcttctccgcctccgccTTGGCGCGCGCAGCCACGTCCTTTTTGGGCGGCCGGCCACGTTTCCGTTTGGGCACTTCC
TCAATGTTCAACGCCGCAGGAGCTCCCGCCAGCATCCCAAAGCCGTCGGTGCCCACAAAAGGCGGCGTAAGACCCAAGGACTCGGCAGTCGCCGGCTGAT
ACGTTGGCGACGCATCACCGCCAGGTGTCGtagaggcagcagcatccgtcTCAGCGCCAGAAGCCGCTTCGGACAccgcctccaccgtctcggcAGACGC
CTCTTCAGCCGTAGCTGTAGCTGAAGCGTCGGTGGTCGACGCTAGACCCGCAGAggctgcagccagcgcctgttgctgcagcggcatCATGAGCGGGAAC
ATGGGCATCATcaagagcgcgagctgctgctgctgcagcgtggcgATATCGCTCGGACTCATgttctggatctgctgctgctgcaattggagcagctgca
gctgttgctgctggagctgctgctggaggagcgcctgctgctgctgctgctgctgcgccgcgtCGCCGCCCTTGGGCGAGCCGTCCGCCGCCggcttggc
ctcgtccacgacCTCTGAAGGCGGCGTCATTCCGGTGTAGCTACTCGAAGCGAGGGGGGATTTCTTCCTGTCGTTGCGCGCCGTGGAGCGGAATTAAATC
CAATAATGAGTGGAGAAGCGCAGCGCGCTGCCATTCGACAAAATGCGGAAAAAGCCAGCCGAGCTTTCCAGATTTCTGATTGGCGGAATGTGTACGGCGC
GTCGGGATTGGCCGATGCAGatgtcacttcaacatggccaCGGATCGGCTAGGCTCCAGGTGGGGCTGCCTTGTATTGCTAGACACGACATGTGAACTTT
ACGATGCATCGGTGCGTTAAATGTACGTGGCAGTTAGTGCAGTTGCCGTACATCATCAACACAGATCTGAAAAACAACATGCACAACCGCTTACAGGGAA
GGCCGCTACAACAAACTGGTCTTTTTTGCTTTGCACCGAGTCGCAGGAAGATGTCCTCGACGCGGAGACTTTAGCGTCAGGGCGGAATCTCGTAGTCCCT
CCTTGCTTGCATCCGATGATTCTGCAATCGCTGTAGTTGTAGCTACAGCAAACCGTGCGCCCCCACCCtgaacacacacacagcagaCAGCAGATCAGGA
GAGACCATACCACAACCTACAGGATTGCAGGTCGGCGTGTTGATATGTTGACACTTTCACGAATTTGAAGTGACGAGGCATCCCCCAAGTGCGTTTCCAC
GTTGTCTCGACCACTACGATCCCGACGAACCGGCAGCTACACTGCTTCTTGTAGACTGGTACCATCCATGACGACGCTCAATGAATGGCCATCGCGTTCA
TGTCCAGCGCAGTCGTGCCGCGCCATTCAACAATCGCAGAGCTGTAGCCGGAAGCAGCTTCCATCCGCGTCAAATCCCGCGGCAATGTCACGAGCGGCGC
TTCTCTAGGCTTTCCGCCACCCTCGACACTCtctcattctccaatttaCCACCACCTGGGCAAGCGGGCCACATACAAGCGTCCAACACGAAAcacggcg
gcgctgcaagcttcaagctgctcgtgcagtATTTCGGTGGCAGCGCTCCTTTCGCGCCACCGGCCGATGGCTGCTGTCCCCGGACACATCTGAAGTAGCA
ATTAGGGGTGGATAGACCACCAGACCGTTTACAATTCCCAAGATAAACGCGGGCTGAGTTGCGCAATAAGGGCGCCGCCCTCCTCCGCACAAAGCCTCTT
GTCTTTGTtgcgtggccaccaccgccagacGAGCGAGCAGTCCTCAAAAGAGCTCCTTCCGGATCAAGAAACCCCTCGGGAAGCCCCTTACTCGCCATAA
TGAGCCTCATCCGCCAGTCCATGCGTGCCCTCAAGGCCGGTATGTTCCTCCCCCGTGTCTCCTCGCTCGAAGCACGCTCTTCCCGTGCCAAATAGCGCCG
TATTGCCCGAGATCTTGCAAGTTTTGTGTATCAACTGGTGCTGACTCTTGCTCTCGCATTCTCTCTTCATTGCAGTGAACACCACGGCCGCTATCCGCCC
CGCCGTCGCCCGCTTCTCCACGGACGGCAAGGTGCACGGCGTGCCTATTAACAACACGCCCACCGAGGACGTGCAGGTCGTGATTCCGGAGGTGCACCAG
ACGCTCGAGTGGTGCCTGTCGTCGCCCCCTCCCGTTCACCAGTTCGACGAGGCCCCGCTGGTCATCGAGACGTACGGCGACGTGGACCCGTACCACTAga
tcagcagcttggacacaGTCGTCGGTGCATAAGTATCACGGGTGAAACGAGACAAACGAGCGCTTGCAGTGCAGTACCAGTTGGCGCGTTGACCTGCCTG
AGGCGGCTCCAAATTCAGAGAAAAAAATCAAAAAGACAACACAAACTTGGTAACTTTTTTGCGAACAGGCATGCCGACTGCTGTCCCTACGTAATTGCCT
TGTTGCATTCGTCTTTCCTGTCTTGGTAGATTGGTGCTTGCTGGCGTGGTAGTGTGACTGAGGGGAGGAAAAACCGGCACGGGGAATACTACTACTTCGC
TCCATTCGCTTTTGCTCAACGCCAACAAGGCAGCATGTGCGGTGACAGCTAGCTGTGCGATTGCTGTCGTGGCCGTGATGAATGAGAATGGTGCCTGCCT
ACCGCCGCCAGGTTTCTTTGATGAGCTGAATGTCCGCGAGGTCGTCGTTAATCATGTTGGTCAGGTGCTCCAATCCctgtcgctgcttgtccATGAACTG
CGATACGCACACAACGCACAACGCTTGTTAGACACCTTTAACGAGAGCGAGTCCACCGCAAGTACGCACCTCATAGAGTCGCTGCAGGTCCTGCGGGCTG
AGCTGACTTGACGGAGGTGGTTGTGCCTCCCtctgcacacgctgcagcgagacAGCGTCATTTAGTCGCGCCTTGTACTGGCCTGGCGAGTCCAGCAatg
tctgcagcttcttcaacgccatcCTGCACAATAGATAATGCCAAGTTAGTCTAAAACAGAGCGCACGCTGGTTTGGCAACAGCGACGTACGCTAGTTGCA
TCTCTTCGCGCTGAAGCGGCTTGCCGTAGTTCTGTAGCAGCTCGATGTCACGCATCACCTTCACTAGCGCGTGGAAAAGCTGCACGTGCTCGTGGCGGCA
CCTTTCAAGCTTCTCCTCTGTGGCACGGGTGTGCTTGTCCATCTCGTTAAGTTGCGCACGAAGGTCGTCCGTGTATTTGTTGTACTTCTCCGCGTGCTCC
TGCTGGGCCTTGATGCGCTTAAGAAGGTTGTCGAAGCCGAGGATAGGAACTGGTGCGCAGTTGAGTGGGTCCGGGTTGTCTAGCTCCGCCTGATTCCACA
AGCGCTCGCTGATGTGTGGTGGTCGAACGTACAGATGCCGCTGGGTCGGGTCCACAGTGTTGTACATGAGGAACTTGAAGCGCGACTGGGCCGGGTCCTG
ATATGCTGCCTTGACTGTGTTCAACTGAGCCACCGATGCATCAGCGCCCAGGATGATCGGGGCTGGCGCGGTCGAgggagcaggtgctgctccAAAGGCA
GAAGGTGCTGCCCCGGGCGTGGTCGTGCCAAAGCCGCCGGTGCCGAAGGCCGATCCTGTGTTTGTGCCAGTAGCAGCACCTGTTCCAAACCCGAATCCAG
TGCCCGTAGTCGCAGGCTTCGCTCCAAATCCAAAGCCACCTCCAAACCCAGTAGTTGTCGTGCTGGTTGCAGCGGGAGTCTGACCAAAAGCTGAAGgcgt
cgcagttgaagcacCACCAAATCCGAAAGACGGTGCCGCGCTAGTCGCTGGTGCAGTGCCGCCAAAACTGAACCCCGTACTAGCCGCCGGGGCTGCACCT
GTTCCACCAAAACTGAAGCCGCCTGACGCAgcgggtgcagcagcaggagcagcccCACCAAAGCTAAATCCACTGCCAGCGCTACCAGCAGCCGGAGCTG
CACTAGTACCTCCAAAACTGAATCCagtgctggcagcagcaggggcggcagcaggtgcagcaccaaaagAGAAACCTGTTGAAGCCGCAGGAGCAGCCGC
CGtgctcgtcgctggtgccgctCCAAAGCCGAACCCCGTTGATCCAGCAGCCGGAGCCGCTGACGTCGCCGCTCCTCCGAAGCTAAatcctcctgctgca
ggtgccgccgccgctggagctgccggcgTCGCGCCAAAACTGAAGCCGCCAGAGGCAgcgggtgctgctgcagctcctccgccgAAGTTGAAGCCACCAG
CCGCGGGTTGCGTCGCTCCAGCCGTCGCACCGAACATCCTAAAGCTTTGGTATTATATAAAAACTCCCCCTGAGGATATTGCAGCACACAGAGACACACA
TTAGACAGGAACAAATGACAATGGCATTTTAGCAGCAGATTCCGCAGCTTATAGGACGAATTAGAGCCACGTGGACATGTCGTTGGAtgcgtctgcgtct
cctcTATACGAATACACTGATAACAGAGCGGATGATACCTGTCAGCGGCGTGGGGGAAGGCT