Description :
From Genome Similarity Track
Location :
contig_40:14341- 15756
Transcript NameFunction/comments
g8603.t1hypothetical protein

Sequence
1415 bases(100 bases per row)
TGTGACAGGCCTCTGTCATACGGGTGCCACCGCGTGTGCGCGGTGGCCAATCAGAGTCGAGCGTACAACCGTTGGTTGGGACGGTCTCGAGTCTCGACAC
TGCATGTCCACATCAATCAATCAGAGTTCATTTTACCTACTTCCTCGCAACTACAGTGTACGTCGGTAACGGGTTCTGTTAGCCCGTTACACCTGGTAGC
ACTTCGTCGTCCGTTCAACGCCCAAGATCAAGATGAACGACATCTCGAGTATGTCGTTGGAGCACGAGAACTTCCCGCACCTGACGCTGATGGAGTGGGA
AGCACTCCACCGCCTGGCAGCGGTGTCAGGCGACACGGTCGTCAAGACGCTCCTGACGACTGGAACGGAACACGAACAACGCTTGTGTGCTCAAGAGTTC
TTAACGCGTGAGCTCGCTGATCTACGTCGGCGTGCGACGACTCCCACGCCGTCCAAGAACAAGACCGACATCGTCAAGCTCGATGTCTCCACATACAGCG
GCGAAGGCAAGACCCGCCTTCACCTGAACCGCTGGTTCTGCGAGGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCTCGCGCGCACGCGCTT
CCTGCTTTCCAAGTTGTCCGGGAAGGCGAAGGAGTGGGCGCTCGGCCGACTCGTGGCCGACGCCTCCTGCTTCCCGACGATGGCAGCTATGCAGGCTGAC
CTGCGACTCGCGTTCGAGCCGCCCCAAGATGAAAGCGTTCAACGGTCGGCATTCCTTTCGCTAAAGCAGGGACGTCTGACCATGCTCGAGTACATTCAAC
GCGCGCGCCATCTCGCCTCGTGTATCACGACGCAGCCAGTCGACATGGCCACACAAGTCCACGTCTTTGTCTCCGGTATGAATGCTGGCTACCAGCGCTT
CTACTTGACCCGCAAGACGCCATCGACGCTGGAGGAAGCCTTCACTGTCGCTTTGCGTGAAGACTATAGTGTGTCGGCATCGCAAGCTTTCGATGTCTCA
CGGCCTCTTGTCCCTGACCCAGAGCCCGAACCCATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGCCTTCACGCCAATCCT
CCACTCGGGGGTCGCGTCCTATGAAGTGTTTTCGATGTGGCAAACCTGGCCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCATGGCGGCGAACGCTAC
GACTGCGAACGACGTCGCCGCTCCAAAAAACGGCGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTTCTCTGGTGGCAGAAC
CTCCTCCTAGCCCTCCCGTGCTTCACGCACGCCTATCAGCCACCACATCTGGCAGCGACTCGAGACTGATCGTACTCAGTCTCCACGTTGAAGGTGCACA
GCGCCCAATACGCGC