Description :
From Genome Similarity Track
Location :
scaffold_106:14337- 16156
Sequence
1819 bases(100 bases per row)
TTAGCACCGTTGCCGACGATGAAAGAGCCGGTGCAGCTCGAGAAAGTCACTTGCGATGGTTCCTACACGATGTCAAGTGTGATAACACTGCGGGGGTCGT
GTAGATACAGTCGATGACCAATTCAGCGGAATTACGCTCATCATCACTTACGGAGGATTCGGTTATTTTGACAGCATGTGGAGTCTCGCAAAGGATTGGC
AATATCGAAGGACCCCATCATTCGCTTGTTATAGAATATAAGGAGACGTCTATAAGGCGAACCCGCACTCTCATCTTCCACTTAAACGCGGAGTTCGGCA
CGAAGTTGATCGTGAACCTGGTTTGAAACATGCAGTGCAGCGACCGTTGCTACTGTCGCGTGAGCAAAGTGAGTATATTGATGAGTTCTTTGCTAAACAG
CGATCTGCTGGTTTGGTGAGAGGGAGCAAGAGGAGCAAGTCCCTTCACAGCGTATCGACGTTTTGTATGTGTAATCCAAATGGTAAATTACGTATCGCTC
AAGCTTACAACAAGTGAAATGCGAAGACGATTTCCGCTCAAGCGCCGATTCCGCGACAAGATATCATCTACCGAATGTCCGGCTGTATACTGTATCGTGT
ACACTGCTAAGCATCACACGAACCTGTTTTGACGCTACTTTTGTTCATCCAAGGACGCAAATGGCAGATCTGTTAAAGAAGTGCAATTGGAGCAACTCCG
TGCGGTGCTGGAATCTATGCGTGAACATTCACTGCAAGCGAATCTTGCAAAGTGTAGTTTCTGTGCTGACGAAGTACCAGTTCTTGGTTGTTTAGTTGGC
GAGCACGGTGTTCGTGCAGACTCCCGAAGTTCGAAGCAATCGTGGAGTGACAAAAGCCACGGAATAAAAGAATTTGAGAAATCGGAGGAATTTGTTTAAT
TATCTGCATCGCTTCTTGCGTATCTTTGCCGAAATGGTAATCTCActatcaaacttgctgaagaaagACGTTCCATGGGAGTGGTCATCGACTTGTAAAG
AAGTGCTTACTCAGATTAAGAACAGCTTGAAGCAACATTACCAGATGATACAAAGCCGTATAGCGTGGTGTGTGACTttctgagtttgcaatcggacgtg
cacgattgcaaaaAGACCCGAAAGCCCACGATCGTGTTTTGTCGtttcaatcgcgacagctgaagcTGGCCGAAAAAAACTAAcctgtccacgacaagaa
gctttcgacaatgaagtatgctctgGTGAAGTTTCGTGCTCAACTCTTGGGTTCAACTCCGTTTGTTGTCTACATGGATCACGCAAGCTTGCGATATGCA
GTTCAGTCTCCTTATTTGACACAGCGGATTGCTCGCTAATGtattctttgcaaaatacaacttCAGGGTTGTATTTACACCGGGAAAATTGAACGCACTG
GCTGAcgcattgtcacgtcgtccGAAATGTGATCTAGCCCATATCAGCTATATCGAAAACGATGGACTCGatatgatacgtcgagcGTATGTTGCAGCTG
AACAgtgtgatctgatcatcaagGAAGTCTCATCGAGTGATTTAGAATTTCATGACAAGCTTCTTGGGCACTTGAAATATTGTATGCATCGTTATGCATT
GAAGAATGGTCCTCTCACTATGAAGTTGCACAAGGTGACGAGCCAAGGGTTGTGGTTCTCCACTTGAAGCACAAGATTTTGTACGAGGCGCATGATACGC
CGATTGCCGGTCTGTTtggccgtgagaagacctactaAACTCTCAGTGCCCAATGTTGGTGGCCCCACATATACAAGTGGGTGGAAACGTGAAgacatgc
gatgtctgtCAGCGCGTGA