Description :
From Genome Similarity Track
Location :
Scaffold_397:143352- 146666
Transcript NameFunction/comments
Aphin_H310_09810Hypothetical protein

Sequence
3314 bases(100 bases per row)
CATCCTCCATTGGACGCTTCCAGGCCATTTGCAAACATCTCGTCGCCTCGCGTCCGCCATCGCGTGCATACGACTAGTTCAGAAATGAATGTGGCTGCAT
GCTGCAGCCGTGGAACCATCGCTTCACCGTCGAAACAGGATGTGGTAGTTCCGCCGCTCGTTACCTCCGCATGCCAGGTAGTGCGTACAACGGACGACGG
GCATGCTCGGCATTAGTCTGCCGAATACAGTTGGTAGCTGCGGCTACAACTCGGTCCCGTTGCCGCTCTCCGCGCCGAGCATGCACCCCATCCCTCGGGC
AACTCAACGGCCCCACGCCACGGCAGTGTCGAACTCGAGTGTGTTAGGTTTGATTCAAATCCCGATAGCTGGACGATTGCTGTAGGTTGCTCGCGCCGAT
GGGTGGCAGCGGGCGACTCGCCGCCGACGCGTTGTTGGACGGCAGCGCACTCGTTAGCCCCGATTGCGTTTTCATCTTTTTTAGTTTGGCAGTCGGCGGC
GGCGCAGGTTTGAGCACGTGCAGCACTCCCACATTCGGGCTCCGCCCAAAAGTTTTGTTGTACGTGTCTTCGCGATTGAGCAGCTCCCGCTTGATGTAGG
CCATTTCGTCGACAGTTTGCTGGACGAGCGCGTCCTTTTCGGCCACGTCTGCACACGCGGTATTGGACGAACCAAGGTCAAATGTCCCGATGCCGTACCA
TGTTCGAGGTCGGCGATGCGATTCAAGTCTTCGAGGCGGCTGTCGCGGCGGGCATAGACCTGCTCCCACTCGCGAATCTTGCTCACAAGCTGATGCTGCT
GTTCATGCAACAGCGCCCGCGTCTTGTCGAATTGGTCTGTCCGATTGTGAAATACGTTGACGTGGTCCACGGCGCTGCCACGTACTGTTGAGCGCCTGCG
TTTCATGCAAGTGCACTTCAATCGTCTGCTCCAACTCGACTTTGTGGTGCTTCCGTGCCAGATCGAGGGCGCGGTCCTTGTCCCGCTGCCAACACAGCTC
CTTTTCGACGAGTTCCGCCTCTTTTTCCTGCGCATGTTTCGGGTCATGTATCGCACGTGTCACAGTGGCCAACGTACGGAAATCGTTTTCTGAAGGGCTT
TCTTGTCGTTCTCGAGGGCAAGCATCGACCCCACGTGCCGTGCGATCGTCTGGTTGCAGCTCTCGACGGTATGTTCCAACTGCGCCACCACTTGGTTGTG
CTGGGCCGTCAGCGTGGCCGTCGCGGTGCGATGTTCAGTGTCCTTTTTCTCCCGTAGGTCGGCCAGCCTACGGGCTAGCTCCGTCGCAGCTCCCTCCAAC
TCGTCTCGCCGCGCCTGATTGAGCTGTTGAAGTTCCTGCGAGTGTTTGGCTAGGAGACCGTCCCGTTCAGACGAAGCTTGGGCAATCACGGCATTGATCT
GTTGGGTGAATGCCGCCTGGATCGCAGAGGTCTCGGCGCCGTGCCCGGCAGTCAGTTGCCGCACGTTTTCGTCGTGGCGCGCGACCATCGCGTTCAGTTT
GTCTTGCCAAGCACTTGCCGCTGCCGTTCGCGCGTTGCTGTGCTCGAGCTCCAACGCCCTGCACGTTGCTGCGTGGGCTTGGACTACAGACAAGACAATT
AATTGTGGCTGCCGTAACCCAGCTACAACACGTACGCTGCGCTCGCCGTTCGTCGTCGAATGCGAGCTGCGCCTCTAGGTGCTTCTGCTTCCACAGATCG
ACCTGCTCTTGCATGTCGGCGACCTCGGCCTTGTGCATCGAGAGAAGAAATGCGCGCTGGTCGTCGACGTGTTGTTGCATGGTTGCTTCGGCCTTGACCA
CGGCTTGAATGAAAAAGATGGTCAGAGTGAACTGGCAGCATGAGACGGACGAACCTTCTTGAATTGTCGCCGCCATGGTGTTGCGCAGCGCTTCAAGCTG
GCCGGCATGTTCTTCTTTCAGCGCTGCTAACCCCTCGGCGTGGTTGCGGCCGTTCATTTCGGTTTTGTGCTTGGCAATCTTCAACTCCCCCTCGAGCTTT
TCAATCGCGACTTTATCCTTGACGGCCCGCTTCGCGGCTTTGTCCTTTTCTGCTTCCTAACCATCCCCGTGAGAACTTTATACAGGATTTCTTCACCAAG
GAAGCAACGTACAAGAGCGGCCAGCTGCGTTTGCCAGACCCTGTGGTCCTTTTGGCTTGCAGCTCCCACTTGCTTGAGCTGATCTTGCAAGGCTTTACAG
TCGGCGAGCGCCTTCTTGTGGAGATCCATTCGCTCCGCGAGGTCGTTCTCGCTCGTCGACAGCGCGCCTTGGGCCTACAACGTTGCTAGGTGTGGAGACA
CTGCCACGGCACTCGTTCCCACCGCTGCCAGCTGCATGTTCAACTGCCCCACGTGTGTTTGCAAATGCTGGATCTGTTTTTCCAATTCAGCCTGTTGGGA
CTGGGATGTGGTCTGCGCTGCCAAGCGCAGCTCCCGGACTGCTTTGTCGTGGTCGTTGGTCATGTCGACTTGTCGCTGCTCAAGGACTTTCACTTCGTTC
TGGAGCCATGCGATCGAGGCATGGAGTTTCCCTTGAGTTGCTTCCCATGCTGCTTCCGCGGCTTGCCTCTCGCCTACACACGATAGTCGTGCATGGAGAT
ACATATGTGTTTTTGACTACACACCATGCGCACGATTCAAGTCGGTTTGGCTCGTCTCGAGCTGTTTGGCCACTGCGTCTTCGCGCGTCGTGGCGGCGGC
TGCGTTGCTCAGCAACTCTTTGTTTTTTTTCTGCGCCGCGAGCAACTGTGTTTTGATTTCGTCCTCGGACTTGGCATGCTGTGTGTCCATGGCCTTGATC
AAGCTTTGCAACTTTTGCACTTCAGCATTTTTGTCGCTGAGTTGCTTCTTTGTCGCAGCAATGTCGGCCTCGAGCGCCTTGATCGACGCGCCCCACTGGT
TTTCTTTATCCGAGAGACTGGACGTTCGTGAGCACCATTCCAAGCAACGATCGATGGCCTCCCGCACCTCGTTGACGTCGACTGGTTCTCGGAATGCAAC
GTATCGACCACCTTGAGCAACTGCCGCCGCTCTCCATCCAGTGCCTCCACTTGAGCGCGAAACTTCGCGAGCTCTGTCTCCAAAAGCACCACTTGGCTTT
GACGCTCGGCTAAGTTGGCGTCGGCATCCTGCAATGCCGCGTCCGCGTTCTGGAGCAGCGTGGATGCACTGCGTTTTTCGTTGAGCAGGTCAATTTCCAC
TTGTTTCATCGACGCGCGGAGAGATGTGAGTTGTTGCAGCAACTCCTACGGAACGATTCATATGCGTTCCTCCAAGCTCGCCATGATTTCCTCACAGATT
TTTCGGACCGCAGC