Description :
From Genome Similarity Track
Location :
Scaffold_14:14334- 18078
Transcript NameFunction/comments
Phyag_g419hypothetical protein PHYSODRAFT_483194

Sequence
3744 bases(100 bases per row)
TGATTGGCTGGAGCTTCGCTTCCCATCTCCAATTGGGTGAAAATCGCCTAAACCTCATGCGCGACGTTGGTTGGCTACCAGCGGTTCGCCGGACGTGTCC
ATTCATTTcctgagctgctcgttcttgtGTCAATTCCGGAGTGTCTCtctcaagctcaagcaactcAAGAATGTCTGGACGTGGATTCGGTCGTGGTGGC
GGTCGCGGAGGCCGTGGCGGAggtcgtggcggtggtggtcgcGGCGGcggtcgtggtggcggcCGTGGCTTCGGCGGAGGCCGTGGAGCCGGCGGCCGTG
GCGGTGGTCGCGGAGCTGGCGgccgtggaggacgtggcggtggccgtggaggaggccgcGGCGGCATGGCTGGCGGCGCCAAGGTGGTCGTGGAGCCTCA
CCGTCACGCCGGCATCTTCATCGCTCGTGGCAAGGAGGACGCCCTGGTGACGCTCAACTCTACCCCCGGCAAGTCGGTGTACGGCGAGAAGCGCATCTCG
GTGGACGTCCCGGCCGCCTCGGGCGAGGGCACCGAGAAGGTCGAGTACCGTGTGTGGAACCCGTTCCGCTCCAAGATCGCTGCGGCCATTCTGGGCGGTG
TGGACAACATCTACATCACCCCTGGCGCCAAGGTGCTGTACCTGGGCGGTGCCTCGGGTACCACCGTCTCGCACGTGTCCGACATTGTCGGACCCACTGG
TGCTGTGTACGCTGTTGAGTTCTCCCACCGTGTGGGCCGCGACCTCATCAACATGGCCAAGTCCCGTACCAACGTCGTCCCGATCATCGAGGACGCTCGC
CACCCGCTTAAGTACCGTATGCTCGTGCCGATGGTCGACGTCGTGTTCGCCGATGTCGCCCAGCCCGACCAGGCCCGTATCGTGGCCTACAACGCCTCGT
ACTTCCTGAAGAACGGCGGCCacttcgtcatctccatcaagGCTAGCTGCATTGACTCGACTGCCCCGCCTGAGGCCGTCTTCGCCCGTGaggtcaagaa
gctgcagcaggagcagttCAAGCCCGCCGAGCAGCTGACGCTGGAGCCGTACGAGCGCGACCACGCTGTCGTTGTCGGCTCGTACCGTGTgcccaagaag
gagaagaagtaGATTCGCGGAGGTACAAGCCTACCCAATGGTTGCACACTACCCTAACTATGCAATGTGTTTTTCTACATGCTATTGCCTTTGTAGGTCT
CCGCCTGGACATGTGGAGCCtacctcttcttctcgatccAAGTGTTCAAGCTGCGCTCTTCCTCTGAAGGAGCTTAGTTGGTGGGATTTTATGTGAGCTG
AGTGTATGGTGGTACATGTTTGCATGTGAGTGGGGCGATTCTGAACGAGGCCTGTTGCTAGGCAGCCTCCTGCTTTCTCGATGATTAGAAACATTGCGTC
GGGCGGACTGAACAAAACGGGGCTCGTTGTCGTCTTCACCCGCTGAAAAGTGGTCTCTGGGGGCGGCGGCGGATCCTATCCGTGATCGAAAGACGTCATC
AAGCCTCCAAGTGGGGTCGATGAGAGAAAGGAAGGGCAAATGATTCATACAATTCGTATGTTTGCATGTTTAGAAGGATAGATTGAGGAAGAGTGCAGCA
AGAGGAGAGGTGGTCGACACACCAAGGGTGGGGACCTGTTGTTTCCGTTCTTCTGTCGTCGTGTTCAAGTCGTACAGCACTAGCATGTTCTGAATTCAGC
TAAATAGCCAATGAAGAATACACGTAGTTGCAGTAGCTCCATTTGTCTATTTCTACATTGTCTTCTTCATATTTTGGGGTCCGGTGCAACGAAGCACGAC
TTCGTGCTGTTTTCCCctgcgcagcttggccagaATGCACCGAGTgagcgagcagcttcgtgatcgTCACCCGTACGCGGATCAGCCGTTCCAAGAGTCA
TACAACCCCTTGGAGGTAGCAaaatgttgaagttgcctttgttTCGACGTTCCTGGACTGAAGAAAAAAGTTTTCTTGTGTGTCTGGCCCAGGTGACGCG
TGCATTCGGCGCTAGAGCAGTCCCGAAGTATGCCGAGCTACTGGCGATGGAAGACCTCCCCGACGAAGACCGCTGCCGTGCACTTCAGGatctgcgcgag
ctgcttaGCAGTCCCAACTTCAAATTCACTGCAGTCATGCAAGAAGTCATGTTTACTTGCTCAGATTTGACGCTGTCACTCTCCGCGGAAGTTCGCGCCC
ATGCGGCACTGGTGATGGCATCGCTGGTTTTGTTCGAGATGGTACGCAACTTTTGCTTCTTTCATAAAGTAAGAGCCAACCGCTAAGTCATCACCTTCAC
GCAGGACACGCCGAACGAACTCAGCGATGAAGTTGTCCTCACCACGGCGACTCGTCTACtaggcgacgacgaggaagaggttGTCGCTGCCGGATGCCAT
ATATTCATCAACCTGTCAGTCTCCAACGAAGGCTGCCTCCTACTCGCCAACAAAATTGAGGCCATAACCACGATAGCAAATATGCTGACAAGCCAACCGT
TATCGAAGCTACCAACTCCAATTGTCGAGTTGCTTGTAGAAGTTCTGGCAAACCTGACGCGTGTCTACGAAGGTGCTCGCACTTGTGCTCAATTCCCCGT
TACCGCGCCAGTACTGTCACTAGTGAAGAAACCGCGTCTGTGTCGAGccgacacgctgctgcactccgCCATGGTGATCatgaacatggctacatatAGC
CAGGCCAAACGTGAGGCCATCCAGCTCGACGCCGTGGAGTTGTGTCTCAAAGCGCTCTCGAAGGTCCTTCTAGGACAAGTGCGTTGCGAAACAACCGAAA
AGCGAGACGAGTTGACTCGCTGCCTCGTTTCAGCAGTCATGACGTTGTCGACCTCCGAGGACGCCAAACCGCGTGTGATCGAATTCGGCATCGAGCCCCT
GGCGCAGTGCTTAACGCACACAAGCGCTGCAGTGCGACTGAACGCCAGTATCACCATCAACTCGGCGTGCGAACTGCCTCGTGGCGTGGCTCCGTTCACT
CAGAGGCTGCTCCGCTCACCGGAATTGCTGGTCGACGTTTTAGGCATTAAGGCCGTGTCGGCTCTGGATAGAAGcgtgagcagcttcgacgacgaggata
CTCCCGCTGCAGTGAAGGCGCTAGCTGTGATACAAGAAAAAGATATGTACGGGATGGCCGACCGCGTTGTGCAGACCTTGGGTATGCTGGACAACCTTGT
CAAAGCTCTGCTCGAAAGTGACGTGCCATCGGAgacacagcaacaagttgcAGATGTGCTTCGACGAATGAGCGAGACAGAAGCGTGTTATCGCCGGCGC
GTGGGCAAATGCATGACGAAGAACAGCATCCCCGAGTCGATTTTTGAGCAGATCATAGGACTGGCGCCTCAAgagttcgacgagcagctcgcgtagtggc
caagttgaagttggatcCTGTGTTCCGAAATGGCTTATACCCCATGACAAACTCGTCAGATGGTATATTTACAAATATATAATCTGACGAGTTATATAAT
GATAGAGGTCGTTGGATGGCAGCCAGAAGCTGccatacaaacatcaagaTGGAGCGTTCGGAGTGGTTTTGGAAGTCTGGACCAAGAGCAAGCATCTATA
GCGGTGCGAGCGATGATAATAAATTTGTGTTCGTTGAGCCGAGAGAAGGTTAGCATCTCCCTCGACAAGGACGGGATTGCGCGTATGCGTATCCAACCAC
TGGATGGTTTAAGCTCTGTCTATAAGACATCTACCAGTTTTTTT