Description :
From Genome Similarity Track
Location :
contig_18:143330- 144741
Transcript NameFunction/comments
g3708.t1hypothetical protein

Sequence
1411 bases(100 bases per row)
CGAGCCATGTATCGCGCCCGGAAGTTTGATTTTGTAGTTCTGGATGACCCTCTGAGCGCGTTGGACGTTCACGTGGCCAATGCCGTGTTTTCAGAGGGCC
TCGCAGGCCTCGCGCAGGGGAAGACACGCCTCCTTGTGCTGAATTCGCACTATCACTTACTGCAGTACGCAGATCGTGTGTTGGTGATGGCGGACGGACA
AATTGTGGGCGATGGCACATTACTGGAGCTGGAACGGGAGTTTCCCTTTTTAGTGACGCCTAACATTGAGAACGACAACGACGGAGATTCAAAGGGTGTG
GATGAAGATGCCCATGCGCTCGAGCGAAAATCGTCGCTTGCAGTTGTTTCTTCCAAAGCTGATGCCGACGGAAACGGGAACCTAGAGACAAGGGGCAAGC
TGATTGTTGCAGAGGATCGGCTGGTGGGGGCTGTGAAGATGAAAACGTATATCGACTACTTGGCTTCGTCCGGGTGGAATGGCTACTTCCTTGCCTCGGT
GGTCTTCACTCTCTTTGCCGTGGCCCAAGTGGCGCTGTTCTTTTGCGATTGGTTCTTGAGCCAATGGTCCAAGGGCAGCTTTGATCTTGCGTCAAAGAGT
TCGTTAGCGATTTACGCTGGACTTGTGGTTGGCTCAGCAATCCTGGTGTTCATTCGCTGCACGTATTTCATGCGAGTGTGCATGGTCTGCTCAGGAATGC
TGCACTCCAAGTATCTTCTGAAGGTCCTGCTCGCCCCAGTCACTACCTTCTTTGATGTTACACCTGTGGGTCGCATCCTCAATCGATTCTCGCGGGACCT
CGACCAAGTCGACAACCCACTTCCATACTGGGCCTTGTGGATGCTGTTGATGATGTTTCAGATGGCTTCAGCATTCATCGTCTGTGCTGCGGCCGACCCG
TACGTGTTGATCATCTACGCTCCAGTTGGCTTGGCGTTTGTCTTTGCGATTAAGGTGTATCAAGCGTCCGCACGAGAGCTCAAGCGCTTTGATAGCATAA
CGCGCTCGCCGTTCTTGAACCTGGTTTCCGAAACGTTGTCGGGTATTGAGACGATCCGATCGTACAAAATGACCGAGAAGTTTTCAGCTCTCTGTGAGCA
GCTCCTGGACCAGAATTCGAAGTACTACCTGCTTTACCAAACATCGTCGAGGTGGTTCGCCATGCGAACCGATTGGCTTGTGTCTGTGATTATTGCGGCG
GTAGCAATTCTAGCAATTGCTACGAAATCAACGCTTGGAGCTTCGGTAGCTGGGCTGGGTCTCACCTACGCAGCTCAACTTACGTCCAGTTTCCAGCGAA
TGACCACCCTCACAACCCAGGTTGAGCAAATCATGACCTGCTTCGAGCGCATCGCGCACTACGGATCGCTTGATGAAGAAGGATACCAACGCGAAGCTAC
CAGCAAAGACG