Description :
From Genome Similarity Track
Location :
contig_94:14333- 18914
Transcript NameFunction/comments
g13244.t1hypothetical protein

Sequence
4581 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGTTAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCCTTCACGCCACTAATT
TTTTGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCACGAGTTGCCCTCCTTCTTCCT
AAGTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCCGCCTCGTGCGATTGCATCACTCCGAAGCGATTCC
GTCTAGTGCGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACGGTTCGGTGTATCCCTTCCAGAAGACCTG
GAATTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAG
CTGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATCCTCGTCCGTTGCTAGCGTCACGTCAGGACGATCAGAGAAAACCTTCACGGCCTTAA
GCTTCGAAACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCC
GTGCCACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCG
TCGTTGTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATC
TGCGCGGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTC
TCCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAA
GCGCGAGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATG
CGCGGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGAT
GGTCTGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACAAGAAGCTCCGTGTTGCCCTTGAACGATTTTGGC
AGAGATGGGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCT
CGCAATCCACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGGCCCCGCCAGTGAAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTG
GTGCCCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGCAACGTTGCAGGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAAT
CGGGTGTGTTACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCGGGTAGTCAAGGCTGCT
ACGTCGCCCCGTAGGTACGACTTCAGGTCCACATCCAGCTTGTACTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTCTTGCATAGCTGCCGGCACT
TGACGGTGCCGTCGGGCTGATCGGGTCACTGCTGATACTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAGGCGGTTGATCGTGACGA
GATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCGCACTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCTTCACA
TGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTGTCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTCACCACGCATCTG
TCGGATGATCAGTTGGAATCTCCACAGATCACAACTCGTCCTCTGTTCTGATCGGACAGTAACTTGAAGCCTAGCAGCAGTCCGCGATATTCGGCTTCGT
TGACAGTCAGATCGTCGGCGAATTCGGACGCGGCAGATATGATCGACCACTCCGGGAGCTTCCAAACAATTGCACTATACGCTCCGGCGCTCCGCTTGAC
GCGTGCTGACCCATCAAAACTGACGACGAGCACTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGTTTGGGCTCTTTCACCGGTGCAA
TCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCACTTCCGGATTTCCAA
GGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACATTCAGCAACCAGGCGAGCGTCGAATACCTCGACAGCACCTTGAT
CGATCGGTTGGTCAGGAGTGTGTAACACATCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAATTCGTTCGACTTCAGCGT
ACGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCGTAGACCACGATCACAGGCTGG
CGATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCACCGATCGTCGGACTCCT
GCTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGGCGTAAACGGCGAAGTCTTCAATGAAGCGACTG
TAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGATCTTTCGGATTGGCTTCCAAAC
CATCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGGTTCCATCGCTCGCAAGCGTCAAG
CAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCGCCTGCCCAGCACCGAAGGTCCCGGGTTT
GCCTCGGGTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGTGTGGTCTCGATCAGGGCTTATCCGGAGGTATCCGTACAGAGCATTATCGATCAGCCTCT
GGTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGGAGATCTTCGTGCACGTTCCGTC
ATGGAGACCACCCAAAACCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGATCAGCGGCATGGGATATAC
CATCAACCTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCTTGATGATGATCACGATGGGGATGCCCATGGTG
AGGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCCACCCTCCGCACGCGTTGGGCGAT
GGGAGCGGCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCTTTACCGATCAGCAAGTGTCGTCGCCGCCAGATG
ATCTGGCGAAGTCGATCGATCTCCTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTCGGTAGTGATCGGCACTTCGG
GTAGGATAGCCATCTGGCTTTCCACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGAG