Description :
From Genome Similarity Track
Location :
contig_94:14332- 18912
Transcript NameFunction/comments
g12725.t1hypothetical protein

Sequence
4580 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGCGGGGACGTTTACCTGGATACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTCTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTCGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGAGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGCATTGCGCGTCTTCGTAGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGTTAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCTTCACGCCACTTTTTT
TGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCGCCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCACGAGTTGCCCTCCTTCTTCCTAAG
TGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCACTACGAGTTGTCCTCCTCCGCCTCGTGCGATTGCATCACTCCGAAGCGATTCCGTC
TAGTGCGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGACCCAAGACGGTTCGGTGTATCCCTTCCAGAAGACCTGGAA
TTCCCGATGGACGCGTCCATATCTGGTCTTACGGCCCGATCGGACATCTGTGATCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAGCTG
TCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATCCTCGTCCGTTGCTAGCGTCACGTCAGGACGATCAGAGAAAACCTTCACGGCCTTAAGCT
TCGAAACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCCGTG
CCACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGTCG
TTGTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCTGC
GCGGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAGGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTCTCC
TCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAGCG
CGAGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGC
GGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGGT
CTGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACAAGAAGCTCCGTGTTGCCCTTGAACGATTTTGGCAGA
GATGGGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCTCGC
AATCCACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGGCCCCGCCAGTGAAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTGGTG
CCCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGCAACGTTGCAGGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAATCGG
GTGTGTTACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCTCGGGTAGTCAAGGCTGCTACG
TCGCCCCGTAGGTACGACTTCAGGTCCACATCCAGCTTGTACTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTCTTGCATAGCTGCCGGCACTTGA
CGGTGCCGTCGGGCTGATCGGGTCACTGCTGATACTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAGGCGGTTGATCGTGACGAGAT
CGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCGCACTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCTTCACATGG
AGGAATTCGTGCTTCGGCCAGGCTTTCACTTGTCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTCACCACGCATCTGTCG
GATGATCAGGTTGGAATCTCCACAGATCACAACTCGTCCTCTGTTCTGATCGGACAGTAACTTGAAGCCTAGCAGCAGTCCGCGATATTCGGCTTCGTTG
ACAGTCAGATCATCGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCTTCCAAACAATTGCACTATACGCTCCGGCGCTCCGCTTGACGC
GTGCTGACCCATCAAAACTGACGACGAGCAGCTCTTCATCCAGCTCTACCGTCGGCGGGGCCATCACGATCGTTCGTTTGGGCTCTTTCACCGGTGCAAT
CGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCACTTCCTGATTTCCAAG
GTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACATTCAGCAACCAGGCGAGCGTCGAATACCTCGACAGCACCTTGATC
GATCGGTTGGTCAGGAGTGTGTAACACATCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAATTCGTTCGACTTCAGCGTA
CGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCGTAGACCACGATCACAGGCTGGC
GATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCACCGATCGTCGGACTCCTG
CTCGGTCCTCATGCTTCCCGTGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGGCGTAAACGGCGAAGTCTTCAATGAAGCGACTGT
AATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGATCTTTCGGATTGGCTTCCAAACC
ATCGGCCGATACCCGATGACCCAAGTACTCTACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGGTTCCATCGCTCGCAAGCGTCAAGC
AGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCGCCTGCCCAGCACCGAAGGTCCCGGGTTTG
CCTCGGGTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGTGTGGTCTCGATCAGGGCTTATCCGGAGGTATCCGTACAGAGCATTATCGATCAGCCTCTG
GTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGGAGATCTTCGTGCACGTTCCGTCA
TGGAGACCACCCAAAACCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGATCAGCGGCATGGGATATACC
ATCAACCTGGTCAGGCTATTCACCAAACGGTAGTCGATGCACAGCCGGATGTCGACTCCATTCTTCTTGATGATGATCACGATGGGGATGCCCATGGTGA
GGTTGATGGCTCAATCATTTTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCCACCCTCCGCACGCGTTGGGCGATG
GGAGCGGCTCCTCCAACGTCGATGTCGCACACCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCTTTACCGATCAGCAAGTGTCGTCGCCGCCAGATGA
TCTGGCGAAGTCGATCGATCTCCTCAGGTGTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTCGGTAGTGATCGGCACTTCGGG
TAGGATAGCCATCTGGCTTTCCACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGAG