Description :
From Genome Similarity Track
Location :
scaffold_118:1433- 5855
Transcript NameFunction/comments
g11897.t1 conserved hypothetical protein
g11898.t1 hypothetical protein PHYSODRAFT_295452

Sequence
4422 bases(100 bases per row)
CGCTTAGGCCCCCAGCGGCTCGGCCTCGACCTCTTCCTCGCTCTTGACGTCGCCCTTGGCCGCGAGCTGGGACGGCTCGTGGTCGTCGCACTGCGCGACC
CACTTGCTCTTGACCGGCATGATGTGGCAGTTGATGCGCATGACCTTCAGCCCCTTCGTGACCTCCAGGTCCACCTGCGTCCAGTTGTTGCGCTGGTCGG
GCATGGTGCAGATGTGGCCCACCTTGGGCTGGCCGCAGCGGCCGCACTTGTACAGCTTCCGGTTCGCGTCGTCGAGAGCCATCTTCTTGCTGGCCGATGA
GGAGGCAGAGGTGCTCACACTGCGACGCGGCGGCGAGCGGCCCGGATTGAGGTCTGCGGGACTCGGCTCCTCCGGAACCGAGAGGAAGCCTAGATTCATC
TGGGACATATCCACCGATAGCCCCGACGAGCGGTTCGGACCGCGCCTGCGAGCGGCTGCGCGGGGCGGCAAGTTGCTTCCTAACGACGAGCGTCGGCCGT
GCAGCGAGTGCACCGCCCCGCTGGCAATCTGAGGCGGCACCTGGAACTGGAACTGCTGCATGTTGGGCTGTGGTGGCGCCGGGAACATGGTCGGGTCCTG
GAAGCTGGCGAACGGGTTGGGGTACCCTTGGTTCGGGTTCATGTTCTGCTGCTGAGCCGACTGCATCTGTTGCTCCTTGGTTTGCTGCGCCAAAATGCGG
AACTGGTCCAGATTGTGAAGCAGGTCCACAGGGTTCGAGTGGTGCCTCGAGTGGTGGTTCACGGGGCGCTTCCGCTTCATCTTGAGCTCATTTACTCCCT
CTTGGATGCGCTGCGAGCGGTAGGCGACGGGGGACGCGCCCCCATTAGTTCCGCCATTGTCGTCCGTCGTCGCTGCGTTCACCACCGGTACCTGTTGCTG
CTGCTGGTCGGGGTTTAGCTCCGACCACGATAGTTCCTTGAGGAACTCATCCATTTCTTGGAACGACTCTCCCTGAGGCGTCGCGGAACCCGTGAACGGC
ATGGGGTTGGTGATCGGGGATTCCCCATGGACAGGTGCAAAAGGCATCATGTGTTGTTGCTGGGGAAAGCCCATACCGTTGGGCCCCATGACAGGCGTGG
AGATGACGCTGGGAGCCATGTTGGCCATGCCGAAGGCCTGCAGCACGTCCGGATTGGAACGCACGCGCTTGTGTTTGTGCTGCGGCGCCACGCGGTAGTT
GGCCCCCACGGCCGTCGAACCGTTCGGGTTGAAGGAGAAGGAGAGTGGCGTGAGCAGGTCGTCGCTCTCGGCCTTGGGCGCCATCATGTTGGTGGGCGAT
GAGCCGGGCACGTCGCTGTCCAGCAGCATTTGGTCGTCGGGCGCCACGAAGCCGGCGGGCGCGTTCACAGAGCCGTCAGCGGGCGCGTCTCCTCCCTCGA
GGAAGTTGTAGTCGAGCGGCAAGCCGTCGAACAGGTCAAGCGTCTGCGCGTCTGCCATGGGGACCGGTTGGGAGAATTCTGCTATAGAGGTCGAAGCTCT
TGTGAGTTCGGTGTGTGCAAATCGAGTTTGGAAGGGACTGGTGCGACAAATTCATGCAGCCTCGGATTGGTCAAAACTCTCTAAACCCTAGCCCTAATCT
ACCAGCTGCCGCCTTGATTCAAAATGGCTACATTATGCAAGCGGCGGCGTCGCAACCGCACTGCAACGGCTTGACGTGTTTGCACGCATCACGTTTGCCG
CTCAAGACGCTGTTAACAAACACTTTCTTAATACTTTCTTCATACATATTATCCACGTGGGGAGGACGCGCGGTTACCCCTCGCTACAGGCTACAGAGTG
TGCGGGAACGCCATGGTCGGCGTGCCGCCGCCGAAGCTCGAGACGCCCATCTCGTACGTCACGGTCTCCGCCGGATGGTGCTCCACCGTCTGATAAAAGG
TTGGGTCCAACGCGCCAGCCCGTGCAGGATCTTGCAACAACGCCTGCAACAACGCACGCGATCGGCCGAACGCAGTCAGCAACCAATTTTCAAGCCCAGA
TCGCCCTCAAGCCGGCGCCGCGCCAACGAAGCGATGCCATCCGTGTCAACTCCAGCAACAAACGTTCGACGCGGCGGCGGCCTTCTTAGAAAAGAAATTC
ACTCACCTGCAGACTCAGCGGGCTCAGCTGCGACGGATCCTGTCGCGGGTACGGGTCCCACATGCCCGCGCCGTTTGCGCCAGGCTGCTGAGACTGCTGG
CCTTGCTGATGCTGCTGCTGTTGCTGCTGGTTGTCGCCTATCCGGGACATAGCGTCAATCTCACCGTTCGCGGCGGGGACGGCGGCCGGGAGCCAGGCCT
CGCTCCCATTCTGCTGCTGGTCGGTCTGATGAACAGGAGACGCGCTTTGGCTTCCAGTGGACGTTTGGCGCTCGTAGTATCGTGGGTCATAACCATTGTT
GGTCGCGTACTCCTGACCCTCATACTGCTGGGGTGGGGCGTAAGGCTGCTGAGCGTAGGCAGCGGCGGCATACAAATTCGGGTCGCCGCTTGGAGAATGG
CCCATTAGCATGCCTCGGTTCTGTTGGTACGGCTCCGCCTTCAGGTCCTCCGTGAGCATGGCGACGTGGCTAATGTGTTGGCCCTGCTGCATCTGCGCCT
GCTGCTGCAAGAGTTTCTCGTGGAGACGCATTTGCTGCATTTGTTGTTGCTGATCAAGCTGCTGCACTGCTTCGGCGTTATGCGCTTGCAAGTGCTGCTG
CTGCTGCAGAAGTTGCATCTGTCGCTGCCGCATCAACGCCGAGTTGTTGTATCCTATGGCCGCCTGTTGTGCCGCCGCAGCTTGCGCTTGCTGTTGGTTC
TTCTTATGCTGTGCGTGTGAAGCCGCAGCCTTGCTCGGGTTCTGTTTCAGCGACTTCCACCGGATCTTCACCGAGTCCTCCGTACGACCCTTCAGAAGCT
GAGAAATCTGCGACCACTTGTTGCCGAGCCGTGCTTGGGCGGTGAGGATCACCGAATCCTCCTCTTCAGTGTAAGGGCCCTTATTAATGGCTGGATCCAG
GTGGTTCTTCCATCGTTCACGGCACTGCTTGGGCGTACGTCCTGGGATACGCTCAGCGATCTGGCCCCAGTTGTTGCAGCCTTGGGTCACCAGATACTCG
AGCACTTGGTCCTCTTCGAACGACCAGTGCCCCTTCACCAAGCCCGGCTTTAGCACCTTGCGCCAACGCTGAAGGCACTGAGCGTGATTGCGCCCAGGGA
CCAGCTCAGCAATAGCCTTCCAGTTCTTTTCGCCGTGGATACGCACGCTCTCACGGAGAGCCGAGTCTTGACCCTTCGTCCAGCGCTTGGTCGTCGGAGC
ATCCGGGTCTTCCCCCAGCTCAGTGTTTCCATTTGAGTTTTCTGCGTTCTCTTCATTAGCTGCCACCGGCGTTCCTGCATCGGAGCGGGTGCGCTGCGTG
GGCTTCTGCTCGCCTTGGACAAGCGTGCGGCTACTCTGCGGACGGTCACGCTTTGCTGCAGACACGTCGTCGTCCTGTGTCGAGAATGTCGCACTGTTGT
CTCCCGGGATAAAGCCCTTCTTGTTGATTTCCAACTCGCGCAGGTTCAACTCCGAGTCTGCAATGTGCGAGTTGCTCAGCAGACGTCCCACCTGCGAGAT
ATCTTCCTTGGAGATCACCACCGATGACGAGGACAACGAGCGTCCAACGACAACACCGTCGGCGTTGGGCATGCCCGCTAGGTGCTGGGCCGTTAGCTTA
TGCCCATCAGCCTCTTTGCTGGAAATTGCACAAAACGTAGAGCAGTTAGCGCAATTAACACAGACAATAGTTGCACTAGGATGTCGTACCCATCGGGGCC
CACCACGGCATTGAACGAGTGGAACTTGTTGGCGCCGCCGTTGAGCATCTTGACGCGGCTGGCAGCTGCAGAGAGAGAGCAAAACGTTAGCATCAAAATC
ATGGAAAGAAAAATGATCTGGCTGAGCGCACCGTTGAGTGCCTGCTTGCGCTTGAGGTGCGACTCCATGTTGTGCTCCTCCTGGGCCTGCACCTCGGCCA
GCTTGGCCTGCTGCACGAGGAACTTTTTGCGTAGATTCAGGATGAACTTCTTCTTGCCCTCGACGGTAGACTCGGCCATGGCTTTGATCACGCGGAACTG
CTTCTCGTCCCGCAGGCGGCCCACGTAGCGGCACAACTCGCCACTCTCGCTCGGGGACAACCCGCTGAGCGACATGAGGAAAAGCCGCGAGGCCTCGGCA
GGCAGCGACTGCAGCAGCTGCGCCAACAAGTCTCCAAAGTTGTCGGTCGCCGCCGATTCCGTGGGCGGCGCCGGCTCCGGCTGGTTGTCGATGGCCGTGT
CCGCCATGCTTGGGCCGTGTGCGTGTCGTAGAGAAGAGGGGCGGGTGCACGCGCGGGCGAATATTGCCTTTTGTCTGCCAGCGGTCGTTCTCCCCCTTGT
CGCTGCGGTTTCCCCTTCCCCT