Description :
From Genome Similarity Track
Location :
Scaffold_1215:1433- 5099
Transcript NameFunction/comments
Phymu_g12942hypothetical protein
Phymu_g12943hypothetical protein

Sequence
3666 bases(100 bases per row)
GCGAGGTTCTGCCACTCGTTGTAGCGCCGCGAGCCGACTGAGATGAAGCCTGGGGCGCGAGGGACGTGGTCGCCAGTCAGCCACAtgccgatctcctcgt
tgTGGTTCAGGGAGATGGCCTTCTCACCGATGTTGGTAAGTTGTAGATAGCGGACTTTGCCTGGGCCTTGGACTAATGTTGGTACCCACTGCTTTCCCCt
tcgcagccacagcttctcgtactcctTCAGGCGGATCCTGTCCGGGTGCTCGAACGTGTCGCCGGGCTCAAGACGGATGCCCTCCTGGAGCAGCAAGGGC
CGGGCTCGGCCGCTGAAGATCTGGCGCCGTCCATGAAGCCGGATCCGGACCTCGTCGTGCAGGCACACGGATCCGTCGCCCAAGTCGAGACGGATGCCTG
CCGGGACCATGAAGTCCATACCGAGGATCGCGTCGCAGTCTAGTGGAAGATCCTCGCCGACCCACACGTCACAGAAGTACACCAAGTATCCAGCTAAGGT
AACCTTGATCCTTGTTCTTCCCATTGCAACGTACAATTGCTCACCAATTCCGAGGCATTCTTGTGTTTGACTAGTGTCGATGTGGGATCCAACCTTACGA
GCAAAGGCGGCGTCGATGATCGACACCTCGGATCCCGTGTCAAGAAGCACGGTGGACTTGGCGTTGTTGATCTTGCACGTTGCCTTCgcctgcttgaagt
gcttgCTGGGTACATGGTACTTCCAGTACCCGCGTGACTCACCGGGCATCAGATCCAAAGCCATGGCGACTTCAGATCGTTGATACTCGTCCACAGAGCG
GAAGCTTGCAACTTTAGCCGTACGTTTCCCATGCAGTTATTATCAAATAGACCCGCTTGCTTGTCGCTAACTTGATCCATTGACTTCTTGTTCACATATG
CATAGATGTAAGACGTAGAACGCTCATCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATcttctcggcagcttcgggcAGCATGTGCTTG
CTTGGATCGAACCACTGCCGAATGAGGTTGTAGAACTCCTCCATCTGGCACTTGCCATGATCATGAAGCTCTCCGCAGCCTCggcagacgaagaagcagc
gatCCGACGGATGGCCTCTCTTGCCACACTTTTGGCAGgtcaagcgcttccagcagccgaGATCCGAGTGCTTGCGGGATCCGCAGTGCGAGCAACGTTG
TCCCTCATTGGGATAGCGAGACCGACGGTCCTGTGACGTGGAGTCCGTGCTGGTCTGGGTCGATGCCTTCAGATCCGGGGATCCGGTCGCTTCCTTGGTC
ACGTCCGCTTGCTTCCGCTCGCTCAACGCTGCCACGTAGGCTCGGCGCAGCTCCCCTTCGGATCCTGACTCGCCCGAGTCAGATCCGTACTCAGACTCAG
CCATTTGCATGGCTCGGATCGCACGTGTGGGACCTGTTGGCTGCGGCACTGCCGGTGGCTTGGGGCGAGGCTTGCTGGATCCAGACGACGGCTTCTTCTG
GCGGGACTTGGCGCGGTACCGCGCACGCAGTACGTCTACCAGTTGTTCGGCGTCGGCAAGCCGCAACAGCGTCAGCTGGTCTGCGAGATCCTGATCGCCG
AGCGTCTCGATGGAGTGCTCGACATGCTCTCGGCGGGACttggcgtctccatccttGACCCTCCGTGGGCACGCATGCCGGCGACGTTGAGGCGGTACAA
GTACTCGAGCGGCGACTCCTCCGAACGCTTGCGCGCATGGTAGTACTGCCAGGCCACGGACACACCAAGGCCACAGTACTGTGTCTGGAAGGATTACAGC
AGCTCGCTCCACTTCAGCCTCGTCGACCGGCCGAGTTGCCGGTACCAGTTCCTCGCCGGGCCCGTGAGCAGATCTCCGAAGGTTAGgcacttctcttcgt
cagAGGCTTGATCCCTTGAGAATGCAGACTTGACCTTGCTTATCCAAGCTCttgctcgttcttcgtcatgatcCTTGCCTGTAAACTCCTTCAAGTCCGA
GATCGCGGAGATTCGGACGCGCTGGATCACACTGCCTCCTGCTGTGGGTGCAGCTGCGGCTGTAGCCGTCGCGAGCGTGCGTCGGGGGTTGCTCCCTCAA
AGTCGTCAGGGTCGTACTCCCAATTGTCGGGATGCGAACCCGTGGACTCCATTTCGACTTCCGGGTGCTTCGACGTTGCGGTCGTCCGCGGGTCAGCGGT
CAGCTGTCGCTCCTTTAAGAACCGATCCATGGCAGACTGGAAGATCATTTCCAGCCTCTCGGTTGACTCGTGTGGCGGGTCCTTGACCAATGTTCGAGTC
GGCAGTTGACCGAGGTTGACTGCGGCGGACACGGGTGCCGGGTCAAGGGTCCTGCTCGGCAAGTGAGCTTGCAGCATGGCAGAACCTGTGGGTCCCAACG
ACATACGACGGGGTTCAGACGAGCTGTCTGAACCGGCCTCCGACGCCGCGGAGGCGTACCGCGACGACCCCGTCTGGTACTCCGGCAAGTGCACCTGCac
gttcttggtcttgcgcCTCTTAGGCACGCTGCGCTCACCGACCAAAGGCTTGAGTCGGTTGAAGAGCGTAGTTGCCGCCGTCCGGATCAggtcgagatcg
agacggaAGAGGGTCTCGCCGTCGAACGCTCCAGCCGTGAAGCCGGCTTCCTCAAACAGCCGAAGGAGTTCCAAGGCGCAGTCCAAGCTAGTCATGGAAC
TCGCAGGCGCCAGCACGGGGCCCGTGAGAGATAGTAGCAACTGGGGTTGTAGGATCTTCATCACCGGGTCGTCCCGAAGGAAGCCCTCGAGTGCGACTTG
CTGCTAGGCGGCTTCCATCTTGGACGACGTCCACTCCGCCTTTGTGGGGGCTTTCTCATCAGAGTCTGACTCTGGtgccttgagcttcttccgcgaggtc
ttcgtcgccttcttcttcgacgacttgGCGCCTGAGACCTTcgcggtggtggtggtggatgaagatccGATAGCTTTCGCCATCGGGTCTTCACCCGGCG
GATCAAAACTTGCGTTTCGATCCGCAGGGGTCCCCGAAGGGACctggggaggaggaggaggagatttcTCTTCCGCGTCCGTCGCCAGACTCGCCTCCTT
CCTGTCGACAGAGCTCCTCCCAAAACTCTGTCGATCCGTGGATCTCGCGTTCAGCGGTGCTGATGGCGATCCAACAACCGTCGGCACTTCTTCTCCCGgt
tccttcttcacttgaaCATCTTCCTCAGAATCACGGTGATATCCGTCACCCGCAAAAGATCCGGGCACGCGCACCATTGTGGTGGAATGGATCCGCTGGA
ATGAGCAGGGATCCTACACTCACACACGGCGCCCAGACACtgactaacggagggggtaCTCCGATAACCGTGGGGTTGCTGAGAGgctcaccttgtgtac
ccgtcaGTGGGCGGGATCTGCTCTCTTGCGGATGAGAAGGGTGTCCAAGTAGTGTGAAGCTTGAAACGTCCTCGGCGGGGACAGGGAGGTTGGATCTTGC
GTGGGTATTCCTGCACACAGGATCCGGGTAGGGGGTAGATCTTGGTCTTGGACTCGTAGATCTTGTGGGTCCTTGGACCCGGGGTTGCCTTGTTGGGGGT
GTATTCCTTTTCCTTTAACTTGTTGCTTGCCGCCTCCTGTAGCGGGGATCTTGGGGGGTTGAGATG