Description :
From Genome Similarity Track
Location :
Scaffold_1429:1433- 3271
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1429-snap-gene-0.0Gene of unknown function

Sequence
1838 bases(100 bases per row)
GGGgTGGGgTCGACTAGAAGACCcATGGTAACACGAGCTTtGTAGTCGCGGATCAAGTCGTTCAGcTtCCcTTGCTtATGCTGCGCGCGCATGTGCTTCA
GAaCATTGCTGCTTCCTGTCGAGGTGATGCCTTTCGCCTCAaGGAACTGCTTCACCGCACGCTCGCCTTAAACAGCCAGTCTATGCACGTCGTCTCGATA
CGTCGCTGACGTTtCATCCAGAGCGAAACCGGTTGTAAAGAAGAGCTTCATGTACGCAACGATGTGGCGCCCCTCGTATCGTCTCTTGCGGTCTGACAGC
ACGCTAAaCAAGCgCGGTTCACCGGCATACCACTCATACCAAATACTTGAAAGGTGAGAGgTGGGGCTTGGTGGCGAGGGACGTTTGTCTTTGCGCTGAC
GCTGGTAGTTGTCGTAGGGTTGCTtGGTGACGCAGAtCGGTTTACGGtCTTTGCCTCCAGAtCTTCAAGACGATTCACGAACAGCCGATAAGCGTGGAGT
AACTCCTGAATGAGCGCAGTTTGATGATCGAGTGTGCTTTGCTCCTTGAGATGCGGAGGATCCTGCATTTGTTGTTCTTGCCTGtAGGTTTTTtGCAAGG
CCATTGAAATGTGAAGCAGCTCATCACGACGGATGCCAGCCTGTGTCGCGCAGTGATCAACTCGGACAATGATCGGACGAGTtGGTTAAAGCGATCGGAG
CATTGGAAGAGCTCGCAGCAGCCGCGCAGTGCACGCATCAAGGACCTTTGCACACACGTTCAGTCGACTGTTTTGTAGGCcGCTGCATGTATTGAAGAGC
TGTGCCTGGAAATCCcGAACGCGGCCGCTTGCTTCTGCATCAaGGTTATCCAACcTGTTTAGTGGGACGTGTGCAGTCGACTCCCAGCCGcTCAaGACCT
TTGAGACACGCTGGTCTGCTTGTGTCGTATtgAAGACATAcGACCAGATCTTcTGGgAaGACGAGAGGTTCCATCCGCcAcGGTCCGAGATCCACTGCAT
GCTCATCCCAGCCTctCCGTTtGCGTGCTGCGCTCCGCCAcGACGAAACGAGTGaGACGAGAGTGATGCTTGAACTCCAGCcGACTTGCTCACACGCCCG
AGACACcTGgTTGTGTGTCCCGGGTGGtGCGGCCGTCTtCTTCTTCTTCATCATCTAGGCGTCGTTGgTGgCcACcaTCGgcACCCccTCcACTGaGTCT
GTCTTGGGCTGATCAACTTGCAACAATATTTCCGTCAACGGAAGCGCCTCGAGGGCTTCGAGGTCGATCTAAACGGGAACAGGTCGGACATGTTCCAGCA
GCTGGACGCAAGGAACGTCCTGCATGGCAAGCGCGACGGCAATTGCGAGAATCGGACACGTCGTAATGTGTTTgTCGGgCTGCAAGGTGAGTCCCTGCTG
GTCGGTAGTCTTGACGCGGACGAGACGAACGAAGAAGTTCCTGCCCGAGCAGACTGACAAGCTCTCCTTCTGAAGCAGGCTGAAGTCGGACGCACGGCCA
AAGATACACCAGAGGACGCTCACCAATGCGGCGTCCTGGTAGTCCGTAGAGCACTTAGCATTTGCATACAAGTATCTAACTATCATAGACAGATCtCTTT
TCGTACATGCAGCGGCATGTTTCGTGACACcGCCAGCCTCTCGTTTCATCATGTACTTCTCCAGGATTCGCCCCATTTCTCGTAGACGCTCCTCAATCGC
ACTTTGGTTGCTAGGATAAAGCTCCAGCAACCAGTTCTTCACGTGACGGAAGTAAGACATGaCAGTATTAGTTGCAAGCaTCTTCtCCTTCACACCGGCA
GTGAAAGCCAGATGCAAAGCGAACTTGTCCATTACCGC