Description :
From Genome Similarity Track
Location :
scaffold_38:143228- 146920
Transcript NameFunction/comments
g12685.t1hypothetical protein

Sequence
3692 bases(100 bases per row)
TCACCGGCAACCACTGTGGATCCATTTTGCATGAGTTGAAGCCGGTCACCTTTGAGCTTTCCGTTCCAACTGATTGTTGCCCCATCAAAAGGAATTGCGA
CGAGACCTCCGGAAACAACTGGGTTAGAAAACTGAAAATTGGTGCTGGCGCACCACAGTTTTGACGGAACTGGGGGTGCAAGGTTCCAGTGTACGTCTGC
ATTCTTGACACCGATCGAAGAGAAATAACCGCAACCAGTTATACCTGTCATGGTTAGAGAAGCAGTGTAGCACCTCCTCGAACCGATGTAGAACTCTATC
TGCCTTTCCTCGCAATTCAATAGCACGCCAAGCACATCGGTGCGATTCCATCGAATTCCGGCAATACCGAGCATTTCCCCACTAATTCCCTCGCGATGGA
GGTACACTCCGCAGAGATGAGCCTCACCAGGAGTGTATGTATTAAGATCTGCCGTACCAAGGGTAACGCCAACAAAGACAGGAGTATCTCCAACTGCACG
CACCGACACTTCCCAATACCACCGCCCTCTGTAGAACAATTTGTCAAAAACGGCAAGTCCCCCGTTTTCACTGGTAGTAGGTGGGGTTTGCGCGCTCTCG
TCATTTGCATCAAGACTTTTATGCGTAATCGTAAGTTTACGAAGATCCGTGCCGAGAGTAATGTACCGAGAGCAGATAATATTTGGGTACTTTGATCCAG
TGGAAGCAGGTAAAATAGCGTACTTCTCGGTACTTTCAACATCGATCGGCGAGCTGTCTGACGCATCGTACTGGATAAATTTTTGCCACCCCTTCCAACC
GATTAGCTCTGTCATCAAGGGTATCAAATTTGTACGTTGAAGTTGGTCCCAGTCTTGGCCCTTGTAGGGAAAGCAGCAAATTTCCAGTACAAGTAGCATA
TCGTGCACAGCAACCTGAACGGTAGACGACGACGATTTCATTTCACTGGGCGCATTATCCACTCCGCTTTCAATAAGCTGCTGGACTTGGCGCAGATGTT
CTGTGGATGCCTTGAGAAGGAATGTCTGTAGTTCGAAAAATTCTTGCCCTATGTCCTCGGATAGCTGAGGTCCAGCAAACTCAAGGTCAACAAGGTAATG
CACTTTGACGGTTGAGTTTTGAGGTGCCGATAGGTTCCCCGAGTTTTGGCCACTGTTAACACGAACCCGCTTAAATGCTGAAGACAGCATCGGAATAACG
TGGAAACGCGAGGTCGGTATAGTTTCCGTGCACTGGAGTAGTCGAACGAACGTCTTCAGGCCTTGCAGGCGCTTTTTAGCGCGATTTTGATGTGCCAGCA
AGATGTCTCGCATTTGGTCTTCTGGGTACCGTGATGACGTCTCGTTCTCTTTACTGGAAGTAATCAGGCAGCTGCTTGACTGCTGAATGAACGCAAAAAT
GTCCGCATGGACCTGCTCGTCTTCCTCTTCCATTACTTCCATCGACTTTGTTTCCATCAGTCTGTTCAGCTGACGGGTAAAGCGTTTTTGCTCAGGCTCT
TCCGGGTTAGCCTCCATCGGCTCTGTTTGGTCCACTTTCGCGAAATCTGCAATTGTAAAGTTCGTAAATAACACCAAGTGAAAATGACTAATATAAAAGT
ATAGTCCTTACCATAGGTCGTTGCGATCGAGATTCCGGGGAGGAGCTTCATTGGAGATGATGCTGATGGAGCGCATTGGATTGGGGCAGGTGCTAACTGA
AGAAGCAGCTGTGCTCGACGAATCACAGGCTCGCAAACAGCATTGTATAGTGCTTGCTGTCTTTCCTTCGCCTCCATATCTGGAGAAAACCCGTTTGGTG
CACCCGTCTCACTGCAATACAAGCAACAATTCTTAGAATCAACATTTCTGGCACGGAGTACGCAAATCAGCTACCTGAAAGCAGCAGCCAATTTCTGTTG
CTCTCGTACGATCCTGATCACAACGAACAATCACTGATGTTAGTCTTCAAAGGAGAGCGAGAACAATTAAATATTCAAACCTTACCAGCGGCGAAGCTGA
AGCGCAGCCTTCCAGGCATCAACTACCGCATCTGCCAGTGCGCCATCGTTTGAAATAGGTTCCGTTGTGTAGGAGATATTGGTGTGTTTCAAAAGAGCCG
CGAACGTAGCACGCACTGCTCGGTCCACTGCCTCGATTCCACCACTCTTTTCCAGTGTCGCTTCAACGCTATCTTGCCTTTTCAGCCTTGCAATTCGTAG
CTGTGGATGTGTGCCACCTGGAGCCGAACCGGGATCTAGAGCATTTCGAACTTTATCCAAAAGCTTTTTACCACTACCAACGTTCTCCATCACTTGCTGA
AGAAGCGTTTCATTTCGAGCCACACCACTATCAAAGTTTGCATCGAGATTAACTTCTTCCAATCCACCACGAAACAGGGGAGAGTACAACCACCGTTCAC
TAACAGCTACACCGTCATCTAATTCACCACCGACAATCAACGTTGCAGCGTAATGACTTCCAACCCAAATTAGTACTTGTTGAAGGTCCTCTAGCCACTC
GTGGCTTTCGTCAATGGTTTTACCGGAGCACTGCGCCATCGATGGAACGGGCTTTGAGAGTGAGTATGGTGCTGGGGGTGGTCCCACGTTGTCCTCAGTT
TTTTCTGGGGTAGGTACAAATCGCCCACTCATAGGGTATATGTGTTGCGAGAGAATTGTCCGACTGGGAACAAACGAAACTTTCTGTGGATCATATTCAA
AAATTCCTGCCTCGACCCTGGTCTTTTGAATTTTAACCAACAGTGCGTCTGTCCCAAAAAGCTTTGAAAGCTCCGAAGGAATAGTCAGCCTGCGAATCTC
GGCGTCGTGGGGCAAATCTTTAACTTTCCAGTATGTGAAACCCTTAGAGTGAATGATCTTCTCCCACAAGCTCTTAAAAATTCGCCCATACGTGACTGAT
GAGCCACTACTCTGGTGAAGTAGGTATGATGAGAGCTCTTTCGAGACGGTTGCAAGCGCATTATCCTCGGAATCAACTTCTACTTCATTTTTTTTCAAGG
CAGCTGGTGATTCAACACCAACAATTGGTGGACGCAAAATACCTCGTTTGCTTAGCAGTACAAGTGCGATATGAGTTTTGCTCGATAAAACTTCCAAGTG
AGACCAAAATGGGCTTAGTATATCAGGAAGTGCATCGCGAACGGATGGTAACGAAAGCACGCTCAGCAACATAAACGGCAGTAATTTACCAGCAAAACTA
TGCTGAATGAAGATGGGGAGAAACCGGCTCTGCTCTAGGCGCATTGTTTCACAACGATCCAGATACTCCGAGATAAATGACACCAACTTCGTGCAGACAG
ATTCAATTATAACCCAGGTTTGCTTGGTAGAGCATGAACACCAAAATATAGTTGCGCGAACCATAATGTTCAGACACTTGAATTCGTGGCTAGTTTCAAG
AGCGTCTAGCTGATTGATGAGAGCAGTTGCATCTTCTGGTGAGCACTCCACCACTTCCTTCGTTTGCTCCCATAGAGCATCCAATAGTGTGCCCATGAAT
GTGATTACAGTGTTTGAAACTACAGCTTCCTCAGAACTGTCCACCTTCAACACCTCCTCAGGGTCACTCATCAATTCAAATAACATTTTCCCTGACGTGA
AGCAGGGTACAAGCATCGGAATCAATAATTTCTGTGCTGGGGTTGGTTCTGCGTCCGAGTTGTGCTTATTTACCATCAAGCGGTTCATCACA