Description :
From Genome Similarity Track
Location :
Scaffold_98:143221- 144958
Sequence
1737 bases(100 bases per row)
AAAGGTATGCAGGTGCCGTTTGCCGTGTGGCATCGAGAGACACCAGAATACTCGCGGTTGAGAACGTTCGGGTGTGCTGTTCTGGCTTATGTCGACAAAG
TTGAGAGGAAAAAGATGGAACCTAAAGCTCGTAAAGCGATTTTCGTTGGCTACAGTCGAGAACAGCGTGGTTACCGCTTGCTAGATAGCAAGACAAACAA
AGTGTTTTACAGTCACACGGCTGTCTTCTACGAGAGTAAGCCTGGACGCGTCTTTACTGACCAAAATCATCCTGAAGCGTCCACAACAGAGTACTTAGAT
GTTGATGGTGATGTTATGGAGAACATCCCATCAATGTTAGAAGCGGGTAATAATGACACACTTGGTGGGGCCGAAGATGAAGAGCGTCAGCACTTGGGTG
ATGTACAGCCACACTGCCGTGATGATCATGAAGGTGGAGCCAATGGACATGATGCACATGTCAGTGACTCCCGAGCAGGTAGGGCCCAAGCTGATGGACG
CTCAGGTGGCGATGTACATGACGAGGTGCAAAGCAGTATAAAGCGAGGTCGATCAAGTGTTGATGTCTCGCACAATGAATCTCGTCGAAAGAAACAGCGG
ACCTGTAAGCAAATGAATCAAAGTGCTTCAAGCACAGCGGCAGCGCGTGGCGCTGGAGACAGTGAGCATTTGCAAGTTGCCCACCTGAGAGGCGGGTTCA
ATGAGCATGGCACAATGCCAACTCGTTGCTCAAAGAAGAAAAGGCACAGTGGGCGGTGCAAGGCACCGGCTGTAGAGGTCCAACCTCAGAAACATGTTAA
TGAGAAAAGTACCACAATGGTTAACGATGAGTTGCCAACCCGTGAGTGGGCTTCTACTCCGATGTCGCGTGGAATGACGACCACAGATTCGGAGATGTCA
CGTTCTCGTGATAACTCGTCAAAGGCGGGTGTAACAACCTCAAAGAAACGGGGATTGCGAGAGTTTGTAGCTTTGGAAGGTGCAAACACAGAGGTCTGCC
CGGTAACACGGAGCGGACGTGTTAGCAAACCACCGTCATGGATTAGCGACTACGTCTACATTGCCTACTCGAACACAAATCCAGACGAGGATGCAGTGTG
TTCTGGGTCTGTTGAATGGGCCAAAGCTCGAGAAGAACTTCAGCAGGCAATGGCAAAAGAGAAGACATTGGCATGGTGGCAGGATTACTGCTGTCTCGCT
GTGAGTATAATCACTGAGCCACACACACTGGACGATGCTCTACTGAGCGAGTATGCCGTGCAATGGAAAGATGCTGCAGATGAAGAGTATCGAGCCTTGA
TGGAGAACTGCACATGGGTGCTAGTACCTCGAGAAAAGCGCATGAAGGTGCTAAAGAATCGATGGATATTTCGTGTGAAGTATACATCAGAGGGTGATAT
TGAGCGCTTCAAGGCTAGGCTCGTTGTCAAGGGATTTATGCAGATCTACGGCATTGACTACTTAGAAGTATACTCACCCGTAGTTCGGCTAGATACTTTG
CGAGCGCTGTTGACTCTTGCCGCAGTATGGGATTACGAGGCACATCAGATGGATGTGACAACTGCGTTCCTCAATGGGGCCATTGACGTAGAGGTCTTTA
TGGAGCAACCCACAGGTTATGTCATTGAAGGAAAGGAAGATTGGGTTTGCTTCCTGAAAAAGAGTCTCTATGGCTTAAAGCAGGCACCACGAGTGTGGTT
TCGGCTGTTGAAATCTTACCTAGAGGAACAAGGATTT